ID: 927999866 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:27514101-27514123 |
| Sequence | CTAGGTATGTTCACTGCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 485 | |||
| Summary | {0: 1, 1: 2, 2: 16, 3: 132, 4: 334} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927999862_927999866 | 19 | Left | 927999862 | 2:27514059-27514081 | CCTGATCTTGTTAGTGGGTTCTA | 0: 1 1: 0 2: 0 3: 3 4: 95 |
||
| Right | 927999866 | 2:27514101-27514123 | CTAGGTATGTTCACTGCTACTGG | 0: 1 1: 2 2: 16 3: 132 4: 334 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927999866 | Original CRISPR | CTAGGTATGTTCACTGCTAC TGG | Intronic | ||