ID: 927999866

View in Genome Browser
Species Human (GRCh38)
Location 2:27514101-27514123
Sequence CTAGGTATGTTCACTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 2, 2: 16, 3: 132, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927999862_927999866 19 Left 927999862 2:27514059-27514081 CCTGATCTTGTTAGTGGGTTCTA 0: 1
1: 0
2: 0
3: 3
4: 95
Right 927999866 2:27514101-27514123 CTAGGTATGTTCACTGCTACTGG 0: 1
1: 2
2: 16
3: 132
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927999866 Original CRISPR CTAGGTATGTTCACTGCTAC TGG Intronic