ID: 928006369

View in Genome Browser
Species Human (GRCh38)
Location 2:27565719-27565741
Sequence AGTCTATCCAGTATCTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928006369 Original CRISPR AGTCTATCCAGTATCTGTGG TGG (reversed) Intronic
901627871 1:10634034-10634056 GGTCCTTCCAGTATCTGTCGTGG - Intergenic
907539768 1:55203171-55203193 AGTGTCTCCCCTATCTGTGGGGG - Intronic
911905641 1:103565155-103565177 CATCTCTCCAGTATCTGTGGGGG + Intronic
918888848 1:190236653-190236675 GGTCTATTCAGTATCAGTAGTGG - Intronic
1071878180 10:89865446-89865468 AGTCTTTCCCCTAGCTGTGGTGG + Intergenic
1071989990 10:91092388-91092410 AGGCTATACAGGATGTGTGGTGG + Intergenic
1072914904 10:99531688-99531710 AGAGTTTCCAGAATCTGTGGGGG + Intergenic
1073001553 10:100289655-100289677 AGTAGATTCAGTATCTGTTGAGG - Intronic
1076688894 10:132210819-132210841 TGTCTCTCCTGGATCTGTGGTGG + Intronic
1083946870 11:65928508-65928530 AGTCTCCCCAGTAGCTGGGGAGG + Intergenic
1086356940 11:86010670-86010692 AGAATATCCAGTATCAGTGCAGG - Intronic
1088159798 11:106855250-106855272 AGTATTACCAGCATCTGTGGTGG + Intronic
1088385343 11:109248083-109248105 AGTCTCCCCCTTATCTGTGGAGG - Intergenic
1088482448 11:110307610-110307632 ACTGTACCCAGTCTCTGTGGTGG + Intergenic
1091924531 12:4334248-4334270 AGCAGATCCAGTGTCTGTGGAGG + Intronic
1095739509 12:45591823-45591845 AGTCTGTGCATGATCTGTGGAGG - Intergenic
1099232459 12:80043118-80043140 AGTCTATTCAGTGTCTGGTGAGG + Intergenic
1101819501 12:108173049-108173071 AGCAGATCCAGTGTCTGTGGAGG - Intronic
1106705091 13:32271492-32271514 AGAGGATCCAGTCTCTGTGGCGG - Intronic
1114646450 14:24259061-24259083 AGTCCCTCCACTACCTGTGGTGG + Exonic
1116966023 14:51016017-51016039 TGTCTCCTCAGTATCTGTGGGGG + Intronic
1119966630 14:78923634-78923656 AGAACATCCAGTATCTTTGGTGG + Intronic
1127977025 15:64005369-64005391 CTTGTATCTAGTATCTGTGGTGG - Intronic
1132702907 16:1229627-1229649 AGTGCATCCAGTATCGGTCGCGG + Exonic
1133169389 16:3971794-3971816 GGTGTTTCCAGTCTCTGTGGTGG + Intronic
1134083919 16:11343421-11343443 AGTCTTTTCAGGGTCTGTGGGGG + Intronic
1142493613 17:294123-294145 AGTTCATTCAGCATCTGTGGAGG + Intronic
1146571114 17:33954170-33954192 TGCCTACCCAGCATCTGTGGAGG + Intronic
1150508831 17:65726956-65726978 AGTCTATACAATATCTTTGCAGG - Intronic
1153570963 18:6473321-6473343 AGTCCATCCAGTCTCTCTGTTGG - Intergenic
1154195644 18:12264473-12264495 AGTCTACCCAGTAGCTGTTTGGG - Intronic
1154201503 18:12303685-12303707 AGTCTACCCAGTAGCTGTTTGGG + Intergenic
1162858542 19:13488331-13488353 AATCTCTCCAGCATCTGTGGGGG + Intronic
925645234 2:6029222-6029244 AGCCAATCCAGTGTCTGAGGAGG - Intergenic
926265549 2:11316211-11316233 CGTATATCCAGTATCAGAGGTGG + Intronic
928006369 2:27565719-27565741 AGTCTATCCAGTATCTGTGGTGG - Intronic
928192588 2:29186659-29186681 TTACTATCCAGTATCTTTGGGGG + Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
945525682 2:210885525-210885547 TGTCTGTGCATTATCTGTGGAGG - Intergenic
946595911 2:221305804-221305826 AATCTCTCCAGAATCTTTGGGGG - Intergenic
947116363 2:226775675-226775697 TGTCCATCAGGTATCTGTGGGGG + Intronic
1171299798 20:24050308-24050330 TGGCTTTCCAGTATCTGTGTGGG + Intergenic
1172824486 20:37769181-37769203 AGTCCCTCCCTTATCTGTGGGGG - Intronic
1173334878 20:42104407-42104429 AGTAAATCCAGTGTCTGGGGAGG - Intronic
1179089767 21:38253849-38253871 AGTCTTTCCGTTAACTGTGGAGG + Intronic
1179279491 21:39922401-39922423 CTTCTATTCAGTTTCTGTGGGGG + Intronic
1179341910 21:40519552-40519574 AGCACATCCAGTATCTGTTGAGG - Intronic
1181853779 22:25768464-25768486 TTCCTTTCCAGTATCTGTGGCGG - Exonic
954452096 3:50577194-50577216 AGTCTATCCAGAGTGGGTGGAGG - Intronic
954505301 3:51065435-51065457 AGTAAATCCATTATATGTGGAGG + Intronic
965432084 3:168601475-168601497 AGTTTGTCCAGTATATTTGGTGG - Intergenic
971674991 4:29614745-29614767 AGTCTATCCAGTGTTTCTGTGGG + Intergenic
974239668 4:59230113-59230135 AGTCTAGCTAGTAGGTGTGGTGG - Intergenic
978267674 4:106845807-106845829 AGTCTATCTAGTTTGTGTAGTGG + Intergenic
983536687 4:168865074-168865096 AGTCTATCCAGTGTGTCTTGGGG - Intronic
983743692 4:171167743-171167765 AATTTATCCAGTATTTCTGGAGG - Intergenic
983874410 4:172859599-172859621 TGTCTATCCTGTCTCTGTAGTGG - Intronic
984114169 4:175658655-175658677 AGTCTATCCACTTGCTGGGGAGG + Intronic
984860150 4:184230545-184230567 AGTCCCTCCAGTATCTGGGCGGG - Intergenic
985819948 5:2152995-2153017 ACTCTATGCAGTGTCTGTAGGGG - Intergenic
985928436 5:3035731-3035753 TGCCAATACAGTATCTGTGGCGG + Intergenic
989839415 5:46043444-46043466 AGTTTTTCCAGAATCTGTGAAGG + Intergenic
989851735 5:46221412-46221434 AATTTATGCAGTATCTGTGAAGG + Intergenic
989852636 5:46234077-46234099 AGTTTTTGCAGTATCTGTGAAGG + Intergenic
992370016 5:76133978-76134000 AGTCTTTCCAGTATAAATGGTGG - Intronic
994329443 5:98488521-98488543 AATCTATCCAGTTTCTGCAGGGG - Intergenic
996729238 5:126701392-126701414 GGTCTATTTAGTATATGTGGTGG - Intergenic
996786286 5:127240041-127240063 AGTCTATCGAGTATTTTAGGAGG + Intergenic
1001902254 5:175442350-175442372 AGGCTTTCCATTACCTGTGGTGG + Exonic
1003312759 6:4983762-4983784 ACTCCATCCAGTTCCTGTGGGGG - Intergenic
1004498386 6:16186256-16186278 ACTCTTTGCAGTTTCTGTGGTGG - Intergenic
1005996594 6:30934928-30934950 AGTCTTCCCACTATCTCTGGAGG + Intergenic
1010370765 6:75104568-75104590 AGTCGATCCAGTATCTGATCTGG - Intronic
1022297057 7:29066108-29066130 AGTTTATCCAGTATCTAGGTTGG + Exonic
1022536398 7:31101314-31101336 AATCTCTCCAGCTTCTGTGGTGG - Intronic
1025550268 7:62238065-62238087 TGTTTATCCAGAATCTGTGAAGG + Intergenic
1028012663 7:85667917-85667939 AGTATATCCAGTGTCTAGGGAGG - Intergenic
1028201841 7:87971595-87971617 CGTTTTTCCAGTATCTGTGAGGG + Intronic
1032156030 7:129469022-129469044 AGTCAATTCAGTCTCTGAGGTGG - Intronic
1037548039 8:19942298-19942320 AGTCAATGCAGTCTTTGTGGTGG - Intronic
1047505199 8:125474176-125474198 AGTCCATCAAGTAGCTGTGCAGG - Intergenic
1048957024 8:139545606-139545628 GCTCTTTCCAGTTTCTGTGGAGG - Intergenic
1050031083 9:1386463-1386485 TGTTTCTCCAGTTTCTGTGGTGG + Intergenic
1050799500 9:9592448-9592470 AGTCTGTCCAGTGTGGGTGGAGG + Intronic
1051717518 9:20000492-20000514 AGTTTATCCAGTCTCATTGGAGG + Intergenic
1060447144 9:123700360-123700382 AGTCTATTCTGTTTCTCTGGAGG - Intronic
1192303471 X:69931951-69931973 TGTTTATCCACTATCTGTTGAGG - Intronic
1197275349 X:124472667-124472689 AATTTATCCAGTATTTCTGGAGG + Intronic