ID: 928009654

View in Genome Browser
Species Human (GRCh38)
Location 2:27595107-27595129
Sequence CAACAGAGGGAGACCGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 4, 1: 1, 2: 8, 3: 113, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928009654 Original CRISPR CAACAGAGGGAGACCGAAGA AGG Intronic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900398670 1:2463857-2463879 CAACACAGGGAAACTGAAGCCGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901669434 1:10847004-10847026 CATCAGATGGAGACCCCAGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906289288 1:44609620-44609642 CAACAGAGGGGGGCAGCAGAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907014006 1:50993404-50993426 GAAAAGAGGGAGGCCGAAGTGGG + Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911561097 1:99405956-99405978 CAACTGGGGGAGAGCAAAGATGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915732170 1:158061411-158061433 CAACACAGGGAGATCAAAAAGGG + Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
917203209 1:172540178-172540200 CAACAGAGCCAGAACTAAGAAGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
917839739 1:178968068-178968090 CAGGAGAGGGAAACAGAAGAGGG + Intergenic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
919742986 1:200991723-200991745 AAACTGTGGGAGACAGAAGAGGG + Exonic
920428617 1:205899447-205899469 CCACAGAGGGAGAGCGAAGCAGG + Intergenic
921082814 1:211756578-211756600 CCACTTTGGGAGACCGAAGAGGG - Intronic
921584031 1:216927336-216927358 CAAGGGAGGGAGCCTGAAGACGG + Intronic
922071069 1:222193906-222193928 CAACAGAGGAAAACAGAATATGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064093516 10:12405666-12405688 CAACAGGGTTAGACCGAAGTTGG + Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064251131 10:13707375-13707397 CAACAAAGGCCGACCGAAGGCGG - Intronic
1067099643 10:43325270-43325292 CAACAGAGGCAGACTGCACATGG + Intergenic
1067183662 10:44009031-44009053 CAACAGAGGGAGGATAAAGAAGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069667593 10:70173853-70173875 CAACACTGGGAGACCGAGGCAGG + Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1074977217 10:118591343-118591365 AAACTTTGGGAGACCGAAGAGGG - Exonic
1076814067 10:132906004-132906026 CAACAGAGGGATGCCAAAGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1080343664 11:31297142-31297164 CAACACAGAGAAACTGAAGACGG + Intronic
1081746010 11:45473095-45473117 CCACAGAGGGAGACCGTTGGTGG - Intergenic
1081860002 11:46327663-46327685 CAACAGAGGGAAAACCCAGAGGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083187551 11:61026471-61026493 CAACAAAGGGAGACAAAGGAGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086507574 11:87521946-87521968 CAGAAGAGGAAGACAGAAGAAGG + Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088567734 11:111190774-111190796 CAACACAGGGAGAACCAAGAAGG + Intergenic
1088907267 11:114164258-114164280 CGAGAGAGGGAGAAGGAAGAAGG - Intronic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091128511 11:133123728-133123750 CCACAGAGAGAGACCCAGGAAGG - Intronic
1091251130 11:134145205-134145227 CCATAGATTGAGACCGAAGAGGG + Intronic
1091339400 11:134798633-134798655 GAACAGAGGGGGAGCGAAGGAGG + Intergenic
1091515585 12:1177523-1177545 ACACAGAGGGAGAGAGAAGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094328799 12:29270072-29270094 AAACAAAGGGAGACCTGAGAGGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097223119 12:57461844-57461866 AAACAGGGAGACACCGAAGATGG + Intronic
1097272576 12:57786223-57786245 CAAGGGAGGAAGACCAAAGAAGG + Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098437114 12:70479670-70479692 CAAGAGAGGGAGAGTGAAGGGGG - Intergenic
1100550771 12:95644487-95644509 CAACAGAGTGAGACTCCAGAAGG - Intergenic
1102584485 12:113913615-113913637 CTACAGAGTGAGAGCAAAGAAGG + Intronic
1103497135 12:121371526-121371548 CAACAGAGAGAGAGAGAGGAAGG - Intronic
1105360836 13:19714513-19714535 CAACAGAGTGAGACTGACAAAGG - Intronic
1105624813 13:22102385-22102407 CCACAGTGGAAGACAGAAGAGGG - Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1107424198 13:40276405-40276427 CAACAGAAGGAGCCCGGTGAAGG + Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1108128976 13:47276623-47276645 CAACAGAGGGACAAAGATGATGG + Intergenic
1108909259 13:55522518-55522540 TAGGAGAGGGAGACAGAAGAGGG + Intergenic
1110430693 13:75419648-75419670 CCACAGAGGGAGGCTGAAGTGGG + Intronic
1112250451 13:97774481-97774503 CAACAGAGGCAGATGGAAGAAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115635025 14:35282861-35282883 CAACAGAGTGAGACCCCACAGGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117450061 14:55841407-55841429 TAAGAGAGGGAGAGGGAAGAGGG - Intergenic
1119706585 14:76786695-76786717 CAACAGAGGTAGGCCTAGGAAGG + Intergenic
1120432095 14:84432187-84432209 CAAGAGAATGAGACCGTAGATGG - Intergenic
1121394302 14:93605788-93605810 AAAGAGAGGGAGTCCGAAGTGGG + Intronic
1121426775 14:93857891-93857913 AGACAGAGAGAGACCCAAGAAGG + Intergenic
1121496602 14:94396172-94396194 GAACAGAGGTAGAGGGAAGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122755825 14:103979265-103979287 CAACAGATGGAGAAAGAAAATGG - Intronic
1125537659 15:40451677-40451699 CAGCAGAGGGAGACCCATGTGGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127377809 15:58401391-58401413 CAAGAGAAGGAGGCCGCAGATGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127946947 15:63764925-63764947 CAACAGAGCAAGACCCTAGAAGG - Intronic
1128076087 15:64826443-64826465 CGACAGAGTGAGCCCTAAGAAGG - Intergenic
1131076856 15:89500786-89500808 CAGCAGAGGGAGACAGAAACTGG - Intergenic
1131089317 15:89609357-89609379 CAACTGTGGGAGGCCGAGGAGGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1136275896 16:29179443-29179465 CAACAGCGGCAAACCCAAGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142080269 16:88145505-88145527 CAACAGCGGCAAACCCAAGAGGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142829039 17:2533850-2533872 CGACAGAGGGAGACAAATGAAGG - Intergenic
1143159968 17:4863225-4863247 CTACAGGGGGAGACAGAAGCGGG - Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1144171234 17:12661844-12661866 CAACACTGGGAGGCCGAGGAGGG + Intergenic
1145769273 17:27480643-27480665 CAACTGTGGGAGGCCGAAGCGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148571176 17:48670534-48670556 AAACAGAGAGAGAAAGAAGAAGG - Intergenic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1153597559 18:6743120-6743142 GAGAAGAGGGAGACCGACGAGGG + Intronic
1155102496 18:22626171-22626193 CAACAGAGGAAGAAAGATGAAGG + Intergenic
1156523256 18:37739925-37739947 AAAAAGAGGGGGACTGAAGAAGG - Intergenic
1158103896 18:53862301-53862323 AGACAGAGGGAGACACAAGAAGG + Intergenic
1160618314 18:80150923-80150945 AAACTGAGGCAGAGCGAAGAGGG + Intronic
1160686925 19:441219-441241 GAACAGAAAGAGACCGACGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162877821 19:13633963-13633985 GAAAAGAGAGAGACAGAAGAAGG - Intergenic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166881240 19:45931388-45931410 CAACAGAGGGGGATGGAAGAAGG - Intergenic
1167357061 19:49010662-49010684 GAACAGAGGGAGCCCGAGGGAGG - Intronic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168402793 19:56095604-56095626 CAACAGAGGAAGGCAGGAGAAGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926412730 2:12621220-12621242 CAACACTGGGAGGCCGAGGAGGG + Intergenic
926893179 2:17656338-17656360 CAAAAGAGGGACAACGAACATGG + Exonic
927148933 2:20184858-20184880 GAACAGAGGGACACTGGAGACGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930678736 2:54232747-54232769 CAAGAGAGGGAGAGCAAAGGGGG + Intronic
931430438 2:62204955-62204977 CTAGAGAGGGAGAGAGAAGAAGG + Intronic
931801326 2:65760827-65760849 GAACAGAGGAAAACCGAAGAAGG - Intergenic
933932811 2:87171975-87171997 CAACTTTGGGAGACCGAAGCAGG + Intergenic
934668961 2:96195866-96195888 CAACACTGGGAGGCAGAAGAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938181520 2:129189105-129189127 GAACAGAGGGAGACAGAGCAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940012743 2:149072176-149072198 AAACATAGGGAGACTGAGGAGGG - Intronic
940255547 2:151724427-151724449 CAACAAAGGGAGACTCATGAAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944316531 2:198291099-198291121 CTACAGGGAGAGACCGAGGAGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945373510 2:209051441-209051463 CAAAGGAGGGAGACCCCAGAAGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945974387 2:216259208-216259230 CAACAGAGGGAGCAGGCAGAGGG - Exonic
946448583 2:219760867-219760889 GAAAAGAGGGAGAGCAAAGAAGG - Intergenic
946822002 2:223640102-223640124 CAACCCAGGGAGACTGAAGGAGG + Intergenic
947267818 2:228302201-228302223 CAACAAAGGGAACCCTAAGACGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169309312 20:4521630-4521652 CACAAGAGTGAGGCCGAAGAGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1173673469 20:44813868-44813890 CAACATAAGGAGATCGAAGAAGG + Intergenic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1181562224 22:23712217-23712239 CACCACAGGGAGGCTGAAGAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182043828 22:27259120-27259142 CAACAGAGAGAGAAGGGAGAAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183310338 22:37106331-37106353 CATTAGAGGAAGCCCGAAGAGGG + Intronic
1183362322 22:37389186-37389208 CCAGAGAGGGAGAGAGAAGAGGG + Intronic
1184106087 22:42368371-42368393 CGACAGAGCGAGACCAAAGGGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184581938 22:45423805-45423827 TTACAGAGGGCGACCAAAGAGGG + Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950656923 3:14442415-14442437 TAACAGAGGGACACAGAAAACGG - Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
954166627 3:48764604-48764626 CAACAGTGGGAGAACATAGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
957207896 3:77221537-77221559 AAACAGAGAGAGAGAGAAGAGGG - Intronic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961578084 3:127854997-127855019 GAACAGAGGAAGCCCAAAGATGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
965653465 3:170958438-170958460 CAAAGTAGGGAGACAGAAGATGG + Intergenic
966503030 3:180667644-180667666 CAAAAGAGGGAGAGAGATGAGGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967216361 3:187213831-187213853 GAACTGAGGGAGACTCAAGATGG - Intergenic
967472670 3:189880516-189880538 CAACAGAAGAAGACAGAAAAGGG - Intronic
967984058 3:195082380-195082402 CACCAGAGGGAGAGAGAAGATGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969806198 4:9610936-9610958 CAACACTGGGAGACCGAGGCAGG + Intergenic
970047984 4:11877356-11877378 TAAGAGGGGGAGACAGAAGAGGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971016784 4:22497109-22497131 GAACAGAGGGAGACAACAGAGGG + Intronic
971086085 4:23276780-23276802 CAAGAAAGGGAGAGAGAAGAGGG - Intergenic
972516177 4:39812684-39812706 CAACAGAGTGAGACCCCATATGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973639123 4:52885932-52885954 CTACAGAGGGACAATGAAGATGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974401538 4:61413673-61413695 CAACAGATATAGACCGAAAATGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977076902 4:92464980-92465002 CAAGAGAGAGAGAGTGAAGAGGG - Intronic
977710621 4:100120232-100120254 CAAGAGAGGGAGAACTAAGAGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980046733 4:127997541-127997563 GAAGAGAGGCAGACTGAAGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982110796 4:152051673-152051695 CAACACAGGGAGGCCGAGGCAGG - Intergenic
982306930 4:153942355-153942377 CAACATAGTGAGATGGAAGAGGG - Intergenic
983412942 4:167421989-167422011 CAACAAAGGGAATCCTAAGATGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985014648 4:185620691-185620713 AAACAGAGGAAGAGCGAAGAGGG - Intronic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
986664638 5:10090098-10090120 CAGAAGAGGGAGGCAGAAGAGGG + Intergenic
988112675 5:26843279-26843301 CAACACTGGGAGACCAAGGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989760272 5:45007401-45007423 CAACGGAAGGAGACCCAAGCAGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992016047 5:72576322-72576344 CAACAGAGCAAGACTGAAGAAGG + Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
997471554 5:134120135-134120157 CAACAGATGAAGACAGAGGAGGG + Intronic
999510232 5:152242477-152242499 AAAAAGATGGAGACAGAAGATGG - Intergenic
999973728 5:156890315-156890337 GAAGAGAGGGAGAACTAAGAAGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1002435044 5:179226063-179226085 GAGCAGAGGGACACTGAAGAAGG + Intronic
1002970988 6:2019480-2019502 CAACAGAGTGAGACTAAAAAAGG - Intronic
1003042886 6:2703999-2704021 CAACAGAGGCAGAGAGAAGGTGG - Intronic
1003218693 6:4137157-4137179 CAACACTGGGAGGCCGAAGCGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003998519 6:11568375-11568397 GAACAGAGGGGGAAGGAAGAAGG + Intronic
1004280590 6:14276400-14276422 CCAGAGAGGGAGCCCAAAGAAGG + Intergenic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005206824 6:23414499-23414521 CAACAGAAGGACACTGGAGAGGG + Intergenic
1006093904 6:31644205-31644227 CAGAAGAGACAGACCGAAGAGGG + Intronic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1007079007 6:39085565-39085587 AAACACAGGGAGACAGGAGATGG - Intronic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008687664 6:53943270-53943292 CAGCAGAGAGAAGCCGAAGATGG + Intronic
1008846056 6:55965515-55965537 CAAAAGAGGAAGACCAAAAATGG + Intergenic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1009816024 6:68736560-68736582 TAACAGAGAGAGACTGAAGCTGG + Intronic
1011625826 6:89282724-89282746 CCACAGAGGCAGCCCGAAGTGGG + Intronic
1013277311 6:108598205-108598227 CAATTGAGGGAGATGGAAGAGGG - Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013661818 6:112305801-112305823 CATCACTGGGAGGCCGAAGAGGG - Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013758024 6:113483816-113483838 CAAAAGAGGGAGCCTGGAGATGG - Intergenic
1014198864 6:118587165-118587187 CAACAAAGGGAATCCTAAGATGG - Intronic
1014623509 6:123698724-123698746 CAACAGAGGAAAGCCCAAGAAGG - Intergenic
1014740606 6:125144143-125144165 AAACAGAGGGAGAAGAAAGAAGG - Intronic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015093242 6:129384670-129384692 CAACAGGGGTAGACTGGAGATGG + Intronic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1017979241 6:159385048-159385070 CAAGAGAGAGAGAGCGAAGAGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019680785 7:2347888-2347910 CAACACTGGGAGGCCGAAGCGGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020327280 7:6984626-6984648 CAACACTGGGAGGCCGAAGCAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022792527 7:33703120-33703142 CAAAAGAGGGAACCAGAAGAAGG - Intergenic
1022888568 7:34672798-34672820 CAACTGAGGAAGATCGCAGATGG + Intronic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026535214 7:71233443-71233465 CAACAGAAGTAGACCTTAGAAGG + Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1031003596 7:116446586-116446608 CATCAGAGGGAGACGTAAGGAGG - Intronic
1032163751 7:129529855-129529877 CAAAAGAGGGCGACCTAAGAGGG - Intergenic
1032854818 7:135825435-135825457 CAAAAGATGGAGACAAAAGAAGG - Intergenic
1032902709 7:136328690-136328712 GAACAGTGGGAGAGAGAAGAGGG + Intergenic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033404427 7:141058096-141058118 CACCAAAGGAAGACAGAAGATGG - Intergenic
1034256525 7:149727753-149727775 CAACAGAGGGAGCCGGGAGTTGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1037007269 8:13797746-13797768 CAAAAGAGAGAGACAGAAAAAGG - Intergenic
1038538641 8:28373004-28373026 CATCAGCTGGAGACCAAAGAGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039025554 8:33254128-33254150 CAACATAGGGAGACCAAAAAAGG - Intergenic
1039163066 8:34644179-34644201 CAGCAGAGGGAGACAGAAAGAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040494291 8:47952415-47952437 CCACAGATGGAGACAGATGAAGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040868876 8:52079565-52079587 CAACAAAGGGAGAACACAGAAGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1047696194 8:127406187-127406209 CAACAGAGTGAGATGAAAGAAGG + Intergenic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1050021055 9:1284945-1284967 CATCAGAGAGAGAACCAAGAAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1058900147 9:109435068-109435090 CAACAGAGGGAGTATGAAGCAGG + Intronic
1058909511 9:109507890-109507912 CAACTGAGAGACACCCAAGAAGG - Intergenic
1061291301 9:129651642-129651664 CAAGAGAGGAAGACTGAAGTCGG - Intergenic
1062407898 9:136406110-136406132 CTACAGAGGGAGACCACAGACGG + Intronic
1062437221 9:136551597-136551619 AAAAAGAGGGAGACCGAGAAAGG - Intergenic
1186195715 X:7108799-7108821 CAACACTGGGAGACCGAGGCTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189200783 X:39194043-39194065 CAACAGTGGGTGAGTGAAGAAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190101607 X:47526426-47526448 CAACAAATGAAGACAGAAGAAGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1194713379 X:97262467-97262489 CAAGTGAGGGAGAACGTAGAAGG + Intronic
1197728792 X:129793609-129793631 CGAGAGAGGGAGACAGAATATGG - Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1198082516 X:133252782-133252804 AAAGAGAGTGAGACAGAAGACGG - Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic