ID: 928017625

View in Genome Browser
Species Human (GRCh38)
Location 2:27673043-27673065
Sequence CTCTGGATTTCTACTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928017621_928017625 -6 Left 928017621 2:27673026-27673048 CCTTTCCAGAGATTAACCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 126
Right 928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG 0: 1
1: 0
2: 0
3: 14
4: 218
928017619_928017625 14 Left 928017619 2:27673006-27673028 CCAAAGGCTTTCTGTTTTACCCT 0: 1
1: 0
2: 1
3: 18
4: 246
Right 928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG 0: 1
1: 0
2: 0
3: 14
4: 218
928017620_928017625 -5 Left 928017620 2:27673025-27673047 CCCTTTCCAGAGATTAACCTCTG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG 0: 1
1: 0
2: 0
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928017625 Original CRISPR CTCTGGATTTCTACTGCAGA TGG Intronic
901426648 1:9185870-9185892 TTCTGTATTTCTACTAGAGATGG + Intergenic
904954391 1:34270938-34270960 CTCTGGCTTTCTTCCTCAGATGG - Intergenic
906641746 1:47445093-47445115 CTTTGCATTTCTCCTGCAGCAGG + Intergenic
908800742 1:67877798-67877820 CTCTGTATTTATCCTGCAGGGGG - Intergenic
909270481 1:73617536-73617558 CTCTGCTTTTCTAAAGCAGAAGG + Intergenic
909893441 1:81035923-81035945 CTCTGGTTTTCCTATGCAGAGGG - Intergenic
909945205 1:81655851-81655873 CTCCTGGTTTCTACTGTAGATGG - Intronic
910733125 1:90420868-90420890 CTCTGCTTTTCTCCAGCAGAAGG - Intergenic
913318640 1:117573831-117573853 CCCTGGATTTCTAATTCAGTAGG + Intergenic
917212606 1:172645580-172645602 CTTGGGATTCCTGCTGCAGAGGG + Intergenic
917518632 1:175729794-175729816 CCCTGGAATTCTACTGAAGATGG + Intronic
918330303 1:183453896-183453918 ATCTGGATTTCTATTTCAGTGGG - Intergenic
919616314 1:199813139-199813161 TTCATGGTTTCTACTGCAGAAGG + Intergenic
923598634 1:235381510-235381532 TTTTGGATTTTTACTGGAGATGG - Intronic
924442625 1:244099213-244099235 CCCCGGATCTCTACTGGAGAAGG + Intergenic
1062762362 10:34667-34689 GTCTTGATTTCTTCTTCAGATGG - Intergenic
1066111275 10:32199216-32199238 CTCAGGATTTCGACTGAAGGAGG + Intergenic
1068790674 10:61028131-61028153 CTGTTCATTTCTCCTGCAGAGGG - Intergenic
1069359828 10:67629584-67629606 CTCTGGATTGCTGCTGCTAATGG + Intronic
1069548502 10:69345811-69345833 GGCTGGATTTCTACTGCACTTGG - Intronic
1070326153 10:75390554-75390576 CTCTGAATTACTACTTCTGAGGG + Intergenic
1071175308 10:82919264-82919286 GTCTAGATGTATACTGCAGAAGG - Intronic
1071479841 10:86056871-86056893 CTCTGTCTTTGCACTGCAGATGG - Intronic
1073417977 10:103400391-103400413 TTCTAGATTTCTACTGAAGAGGG + Exonic
1074596772 10:114875217-114875239 CTGTGGATTCTGACTGCAGACGG + Intronic
1075671083 10:124264584-124264606 CTCTGCATTTCTGCAGCTGAAGG - Intergenic
1077970260 11:7181827-7181849 CTCTGCTTTTCTCATGCAGAAGG - Intergenic
1079665548 11:23100472-23100494 CTCTGCAATTCTTCTGCAGGAGG - Intergenic
1081185225 11:40034378-40034400 GTCTGGTTTTCTTTTGCAGATGG + Intergenic
1081630031 11:44682984-44683006 CTTTGTATTTCTACTGTACAGGG - Intergenic
1083570773 11:63761342-63761364 CTCTGGAGTTCTGCTGGGGAGGG + Exonic
1085989777 11:81827895-81827917 CTCTGTATTTTTAGTGGAGACGG + Intergenic
1087983662 11:104650246-104650268 CTCTTGATTTCTCCTGTAAAAGG + Intergenic
1088170474 11:106990514-106990536 CTCTGGATATCTGCACCAGATGG + Intronic
1089200802 11:116723747-116723769 CTCTGGACTTCCACAGCAGCCGG + Intergenic
1090154569 11:124424177-124424199 CTCTGTATTCCTTCTGCAGAGGG - Exonic
1091775319 12:3181159-3181181 CTCTGCTTTACTACTCCAGAGGG + Intronic
1092391167 12:8081177-8081199 CACTGGTTTTCTTCTTCAGAAGG - Intergenic
1093298883 12:17428527-17428549 CACTGAATCTCTGCTGCAGAGGG - Intergenic
1097098081 12:56565903-56565925 CTCAGAATTTCCACTGCAGCTGG - Intronic
1100095930 12:91036606-91036628 CTCTAGATTCCTGCTTCAGAGGG - Intergenic
1100673593 12:96843055-96843077 CTCTGGTTTGCTACTGCAGTGGG + Intronic
1102977006 12:117214013-117214035 CTTTGGAGATCAACTGCAGAGGG + Exonic
1105323837 13:19352483-19352505 CTCTGAATGTCTACTTGAGAAGG - Intergenic
1105870117 13:24497058-24497080 CTCTGAATGTCTACTTGAGAAGG + Intronic
1107826521 13:44333362-44333384 ATCTGCATTTCTACAGCAGCAGG + Intergenic
1109413894 13:62010280-62010302 ATCTGCATTTCCAATGCAGAGGG - Intergenic
1111399867 13:87720610-87720632 TTCTAGTTTTCTGCTGCAGATGG - Intergenic
1112685225 13:101816831-101816853 CACTTTATTTCTACAGCAGAAGG + Intronic
1112829518 13:103431384-103431406 CTCTTCATTTGTACTGCATATGG - Intergenic
1113354879 13:109569456-109569478 CTCTGTAAATCTACTGTAGATGG + Intergenic
1113354891 13:109569587-109569609 CTCTGTAAATCTACTGTAGATGG + Intergenic
1114243951 14:20895103-20895125 TCTTGGATGTCTACTGCAGAAGG - Intergenic
1114247013 14:20923678-20923700 TCTTGGATGTCTACTGCAGAAGG - Intergenic
1115858246 14:37654873-37654895 CTGTGGTTTTCTAATGCACAAGG + Intronic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1120307310 14:82787158-82787180 CTCTGCACTTCTCCTGAAGAAGG - Intergenic
1121614863 14:95306878-95306900 CTCTGGTTTCTTACTGTAGAAGG - Intronic
1124108140 15:26760424-26760446 CTCAGATTTTCTACTGCAGAGGG + Intronic
1128587916 15:68867276-68867298 ATCTGGTTGTCCACTGCAGATGG - Intronic
1128903934 15:71451005-71451027 CTCTGCATTTTTAGTGGAGACGG - Intronic
1130127036 15:81102706-81102728 ATGTGTATTTCTTCTGCAGAGGG + Intronic
1131008104 15:88995061-88995083 CTCTGGGATTCCACTTCAGAAGG - Intergenic
1131535412 15:93233068-93233090 ATGTGGATTTCGACTGCAGTGGG + Intergenic
1131838039 15:96409618-96409640 CTCTGGACTTCAACTCCCGACGG + Intergenic
1135867438 16:26117209-26117231 ATCTGCAATTCTACTGCAAATGG - Intronic
1136649216 16:31652004-31652026 CTCTGGACTTCTAGTAGAGACGG - Intergenic
1138152715 16:54673754-54673776 TTCTGTATTTCTACTGCACCTGG - Intergenic
1140899512 16:79354876-79354898 CTCTGGATTTCTCATACACATGG - Intergenic
1146699685 17:34945693-34945715 TTCTTGATTTATACTTCAGAAGG - Intronic
1148601949 17:48900977-48900999 CCCTGGAGGTCTACTCCAGAGGG + Intergenic
1149019126 17:51943233-51943255 CTCTGGATTTCTAGAGAAGCTGG + Intronic
1150684154 17:67306776-67306798 CTCTCTTTTTCTAATGCAGATGG - Intergenic
1152793928 17:82297589-82297611 CGGTGGATTTCTCCTGCAGTCGG + Intergenic
1152955272 18:34997-35019 GTCTTGATTTCTTCTTCAGATGG - Intergenic
1153367361 18:4272629-4272651 CTCTGGCTTTTTACTTCATATGG - Intronic
1153851508 18:9099626-9099648 CCCTGGATATTTACTCCAGACGG + Intergenic
1154154234 18:11931196-11931218 CTCTGAATTTCTCCTGCCCAAGG - Intergenic
1154301671 18:13198958-13198980 CTCTGGATGTCTCATGCAAATGG + Intergenic
1155002256 18:21698749-21698771 CTCTGTATTTTTAGTGTAGATGG + Intronic
1155331364 18:24721871-24721893 CTCTGGATCTCTCCTACACACGG + Intergenic
1156882096 18:42092934-42092956 CTCAGGATTTTTTCTGGAGAAGG - Intergenic
1157195747 18:45618914-45618936 TTCTGCAATTCTACTGGAGATGG + Intronic
1157229233 18:45898656-45898678 CTCTGGCTGTCTGCTGCACATGG - Intronic
1159734184 18:72073920-72073942 ATATGGATGACTACTGCAGATGG - Intergenic
1160505672 18:79425611-79425633 CTCTGGGCTTCTGCTGCCGAGGG + Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164424160 19:28125444-28125466 CTCTGAGTTTCTGCTGGAGAAGG + Intergenic
1168627066 19:57927646-57927668 CTCAGGATTACTGCTGCAGGAGG - Exonic
925035485 2:682077-682099 CTCTGGATTTCTGCTTCCCATGG - Intergenic
925629175 2:5871408-5871430 CTCCGCATTCCTACTGCAGATGG + Intergenic
925696628 2:6586895-6586917 TTCGAGATTTCTACTGAAGATGG - Intergenic
926243534 2:11105488-11105510 CTCTGGATTCCCACGGCAGCCGG - Intergenic
928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG + Intronic
930388006 2:50722009-50722031 GTCTGAATTTCTTCTGCAGGAGG + Intronic
931678367 2:64720758-64720780 CTCTGGTTTTGTGATGCAGACGG - Intronic
932139453 2:69262727-69262749 GTATGGTTTTCTATTGCAGATGG - Intergenic
933127764 2:78632403-78632425 CTCAGGATTTGTACACCAGACGG + Intergenic
934028814 2:88023157-88023179 CTCGGATTTTCTACTGCACAGGG - Intergenic
940468668 2:154064829-154064851 CTCTGCATTTCTCAAGCAGAAGG - Intronic
943789111 2:191911756-191911778 ATCTGGATTACTACTCCTGAAGG - Intergenic
944092430 2:195927356-195927378 CTCTGGATTTCTACTCTTGCTGG + Intronic
944340943 2:198598235-198598257 CTCTGGATTTCTAACTAAGAAGG + Intergenic
945899092 2:215517988-215518010 CTATAGATTTCTCCTGCATAAGG - Intergenic
948006767 2:234616061-234616083 CTCTAGTTGTCTACTGCAGGAGG - Intergenic
1175126224 20:56753824-56753846 CTCCAGAGTTCCACTGCAGATGG + Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179994261 21:44966768-44966790 CTGAGGATTTCTCCTGCAAAGGG - Intronic
949899439 3:8797893-8797915 TTTTGTATTTCTACTGGAGATGG + Intronic
950928937 3:16770222-16770244 CTTTGTATTTCTCCTGCAGCTGG - Intergenic
953549088 3:43886597-43886619 CTCTGGATTCCCAGGGCAGAGGG - Intergenic
954624620 3:52015842-52015864 CTCACGATCTCTCCTGCAGAAGG - Intergenic
954764562 3:52902441-52902463 GTCTGGATTTCACCTGCAGCTGG - Intergenic
956361074 3:68448037-68448059 CTCAGGAATTCTGCTGCAGTTGG + Intronic
957006809 3:74958006-74958028 TTCTGGCTTTCTATTGCACAGGG - Intergenic
957456186 3:80450463-80450485 CTCTGGATTTCTATTACATCAGG - Intergenic
958164302 3:89859619-89859641 CTCTGGATTTCTAATCCATCAGG + Intergenic
961008993 3:123423713-123423735 GACTGGATTCTTACTGCAGAGGG - Intronic
961084817 3:124057752-124057774 CTCTGTATTTCTGCTGCTCAAGG + Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
968784368 4:2608696-2608718 CTCTGAATTTCTCCTTCAGTGGG - Intronic
969730126 4:8950327-8950349 CTCAGGATTTCATCTTCAGATGG + Intergenic
969789732 4:9484441-9484463 CTCTGGATTTCATCTTCAGATGG + Intergenic
970385337 4:15550362-15550384 CTCTGGAGTGCTTCTGCATATGG + Intronic
971728120 4:30339562-30339584 GTTTGTATTTTTACTGCAGACGG - Intergenic
972104148 4:35461671-35461693 CTCTGGTTTTTTAAAGCAGAAGG + Intergenic
972395805 4:38658706-38658728 CTCAGCATTTCTAGTGCAGGTGG - Intergenic
972647177 4:40980192-40980214 TTCTGGATTTTTAGTACAGAAGG + Intronic
972818954 4:42676864-42676886 CTCTGGATTCCTTCTGGGGAAGG + Intergenic
974163781 4:58173874-58173896 CTTTGGCTTTCTTCTTCAGATGG + Intergenic
975253584 4:72209052-72209074 CATTGGACTGCTACTGCAGATGG - Intergenic
976919377 4:90419239-90419261 CTCTGTATTTCTACTTCAAAAGG + Intronic
977809778 4:101346329-101346351 TTATGGTTTTCTTCTGCAGAGGG - Intronic
977966803 4:103160632-103160654 CTCAGCCTTTCTACTTCAGAAGG + Exonic
978279338 4:106991328-106991350 ACCTCGATTTCTACTGCAGTGGG - Intronic
981942709 4:150301840-150301862 CTTTAGATTTTTACTTCAGAAGG - Intronic
982440046 4:155424507-155424529 CTCTGGTTTTCCTATGCAGAGGG + Intergenic
983701764 4:170605281-170605303 ATCTGGATTTCTGGTCCAGATGG + Intergenic
984452211 4:179916711-179916733 CACAGGACTTCTAATGCAGAAGG - Intergenic
984587563 4:181580814-181580836 CTCTAGATTCCTACTGAAGTTGG + Intergenic
986164081 5:5258447-5258469 TTCTGGATTTCAGCTGCAGCAGG - Intronic
991016453 5:61937999-61938021 CACTGCATTTCTGCTCCAGAAGG + Intergenic
991170936 5:63625194-63625216 CTCTGGAGTCCAACTGCACAGGG + Intergenic
992565569 5:77992527-77992549 TTCTGGGCTTCTACTGGAGAAGG + Intergenic
992601863 5:78409129-78409151 CTCTAGTTTACTAGTGCAGATGG + Intronic
992659912 5:78948918-78948940 CTCTGGGTTTCTAATTCAGCTGG + Intronic
994096087 5:95849377-95849399 TTCTGCATTTCTAGTGGAGATGG + Intergenic
995434293 5:112118643-112118665 CTTTGGATTTCTGCTCCAGTAGG - Intergenic
995834420 5:116386002-116386024 CTCTGGAATTCTAGGGCAGGTGG + Intronic
998588906 5:143456675-143456697 CTTTGGCTTTCTCCTGCAGTTGG + Intergenic
999333914 5:150698796-150698818 CTCTGAATTTTTGCTGGAGAAGG - Intronic
999366535 5:151027316-151027338 GTCTGGATTTATTCTGCAGTGGG - Intronic
999961904 5:156764955-156764977 CTCTGGCTTCCTACTGCAACAGG - Intronic
1000185742 5:158856131-158856153 CTCTGGGGTTCTTCTGCTGATGG + Intronic
1000763187 5:165252195-165252217 TTCTGGAATTTTCCTGCAGATGG + Intergenic
1000785763 5:165541599-165541621 CTCTGCATTTATCATGCAGAAGG - Intergenic
1003639346 6:7863490-7863512 CCCTGGATTTCTGCTGAAGAAGG - Intronic
1004324100 6:14658158-14658180 CTCTGGTGTTTTCCTGCAGATGG + Intergenic
1006721226 6:36153054-36153076 TTCTGTATTTTTAGTGCAGAGGG + Intergenic
1010324599 6:74550202-74550224 CTCTGTTTTTCTCATGCAGAAGG + Intergenic
1016171793 6:141026647-141026669 CTTTGGGTTTCTCCTGCTGAGGG + Intergenic
1017000352 6:149992240-149992262 CTCTGGTCCTCTATTGCAGACGG - Intergenic
1020718497 7:11710598-11710620 TTCTTGAGTTCTAATGCAGAGGG + Intronic
1020890826 7:13876069-13876091 ATGTTTATTTCTACTGCAGATGG - Intergenic
1021280950 7:18717599-18717621 CTCTGTATTTTTAGTGGAGATGG + Intronic
1021622135 7:22559500-22559522 CTCAGGATTTCTATTTCAGTAGG + Intronic
1023052667 7:36266799-36266821 CTCTGGATGTCTTGTGCAAATGG + Intronic
1023056579 7:36295479-36295501 ATCTGGAATTCTGCTGCACAAGG - Intronic
1023258543 7:38335802-38335824 CCCTGGCTCTCTTCTGCAGAGGG - Intergenic
1023259197 7:38341457-38341479 CCCTGGCTCTCTTCTGCAGAGGG - Intergenic
1023260604 7:38354477-38354499 CCCTGGCTCTCTTCTGCAGAGGG - Intergenic
1023261582 7:38363621-38363643 CCCTGGCTCTCTTCTGCAGAGGG - Intergenic
1023284062 7:38601153-38601175 CTCTTGATTTCTATTACAGAAGG - Intronic
1024928893 7:54648713-54648735 CTCTGGATATTAACTGCATAAGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026197245 7:68183854-68183876 CTCTGGAATTCTCATGCAGCTGG + Intergenic
1028667378 7:93362494-93362516 CTTTGGATTTCACCTTCAGATGG + Intergenic
1031977042 7:128100771-128100793 ATCTGGATTTAGACAGCAGAAGG + Intergenic
1034854767 7:154532915-154532937 CTCTGACTTTCTTCTGAAGAAGG + Intronic
1036122912 8:6037435-6037457 TTTTGTATTTCTACTGGAGATGG - Intergenic
1037242304 8:16791200-16791222 CTTTGTATTTTTAGTGCAGACGG + Intergenic
1039446083 8:37633966-37633988 CTCTGGAGTTGGCCTGCAGAAGG - Intergenic
1040412099 8:47164808-47164830 ATCTGGATTCCCACTGCACAGGG - Intergenic
1041393214 8:57366328-57366350 CTCTGAATTACTACTGAAGTTGG + Intergenic
1041529270 8:58844607-58844629 CTCTGGTATTCTACAGCAGTGGG + Intronic
1042100880 8:65273878-65273900 GACCTGATTTCTACTGCAGAGGG - Intergenic
1044334303 8:90960778-90960800 GTCTGGTTTTTTTCTGCAGATGG + Exonic
1045921953 8:107540780-107540802 CTCTGCTTTTCTAATGCAGAAGG - Intergenic
1048473604 8:134724137-134724159 CTCTGGAGTTCCTATGCAGATGG - Intergenic
1050298008 9:4226599-4226621 CTATAGAGTTCTACTTCAGAAGG - Intronic
1051923799 9:22299046-22299068 CTCTGGTTTTCTCAAGCAGAAGG + Intergenic
1052356084 9:27506108-27506130 CTCTGGATCGCTACTGCAGTGGG + Intronic
1054759641 9:68992984-68993006 CTCTGTATTTTTAGTACAGATGG - Intronic
1055520752 9:77078662-77078684 CACAGGAGTTCTACTGCAGAAGG - Intergenic
1056429345 9:86511836-86511858 TTCTGGAGTTCCACAGCAGAGGG + Intergenic
1056450125 9:86708776-86708798 CTCTAGATTTCTGCTGAATATGG + Intergenic
1056696277 9:88856739-88856761 CTCTGGATTGGTACTGAGGAGGG - Intergenic
1058069839 9:100590805-100590827 CTCTGGATTCATAATACAGACGG - Intergenic
1059869843 9:118560757-118560779 CTTTGTATTTTTATTGCAGATGG - Intergenic
1060122390 9:121005653-121005675 CTCTGGACTTCCACAGCACATGG + Intronic
1187185205 X:16977867-16977889 CTCTTCATTTCTGCTCCAGATGG + Intronic
1187612866 X:20961380-20961402 CTCTGCTTTTCTCATGCAGAGGG - Intergenic
1188187551 X:27133235-27133257 CTCTGGGTTATTACTGGAGAAGG - Intergenic
1188315753 X:28671478-28671500 GTCTGGATTTCTAGTCCAGCTGG + Intronic
1189496954 X:41517187-41517209 TCCTGCATTTCTACTGCAGTGGG + Intronic
1197137337 X:123077463-123077485 GTCTGCATTTCTACTGCATTGGG + Intergenic
1198610111 X:138389443-138389465 CTCTGGTTTTCTGCAGCAGAGGG + Intergenic
1199285516 X:146050206-146050228 CTCTGGTTTTCCTCGGCAGAGGG - Intergenic
1200371574 X:155730874-155730896 CTCTTGATTTCTTTTTCAGATGG - Intergenic
1200613311 Y:5349510-5349532 CACTGTATTTCTACTGCCTAAGG + Intronic