ID: 928022093

View in Genome Browser
Species Human (GRCh38)
Location 2:27713354-27713376
Sequence AAGGCGAATTTGCAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928022086_928022093 23 Left 928022086 2:27713308-27713330 CCAGAGGGCACGCCAGAGAAAAT 0: 1
1: 0
2: 0
3: 9
4: 97
Right 928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 109
928022087_928022093 11 Left 928022087 2:27713320-27713342 CCAGAGAAAATAGAAGCTCTAAT 0: 1
1: 0
2: 3
3: 27
4: 233
Right 928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928022093 Original CRISPR AAGGCGAATTTGCAGGTGGT AGG Intronic
905172942 1:36119720-36119742 AAGGAGAACTTCCGGGTGGTGGG + Intronic
905975709 1:42172230-42172252 TAGGGGAATTTGCAGGAGGAGGG - Intergenic
906247841 1:44289656-44289678 ATGGCTCAGTTGCAGGTGGTAGG - Intronic
906493257 1:46284728-46284750 AAGGAGAGTTTGGAAGTGGTAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910322071 1:85957398-85957420 AAGTCAAATTTGCAGGTGAGAGG + Intronic
918613169 1:186514631-186514653 AAAGGGAATTTACCGGTGGTAGG + Intergenic
1064552813 10:16520572-16520594 CAGGTGAACTTGCCGGTGGTGGG + Exonic
1068830220 10:61485420-61485442 AAGAAGAATCTGCAGGGGGTAGG + Intergenic
1068853646 10:61773948-61773970 AAGCAGAACTTGGAGGTGGTTGG + Intergenic
1072004253 10:91227889-91227911 AACCCAAATCTGCAGGTGGTAGG - Intronic
1073352719 10:102831292-102831314 AGGGTGAATTTGCAGTTGGTTGG + Intronic
1073888714 10:108071747-108071769 AAGGCGAGTTTGGAGGTGATAGG - Intergenic
1074103871 10:110374640-110374662 ATGGTGAGTTGGCAGGTGGTGGG - Intergenic
1074186034 10:111100222-111100244 GAGGAGAATTTGCAGGGGGCTGG - Intergenic
1075477972 10:122753035-122753057 AAGGAGAATTTGCAGGAGTATGG - Intergenic
1078822657 11:14897615-14897637 AAGGGACATTTGCAGATGGTTGG + Intergenic
1081639647 11:44743917-44743939 AAGGCAGATTTGCAGCTGTTAGG + Intronic
1083697588 11:64453151-64453173 AAGGGGAAATTGGAGGTGGGAGG - Intergenic
1085453916 11:76655244-76655266 AAGGAGATTGTGCAGGTGGGTGG + Intergenic
1089564099 11:119361791-119361813 AAGGCCAATTGGCAGCAGGTGGG + Intronic
1093444732 12:19243629-19243651 AAGGAGAATTTGTAGATGGTGGG + Intronic
1093824492 12:23666969-23666991 AAGGAGAAATTGAAGGTGGTGGG - Intronic
1095948430 12:47767063-47767085 AAGGCGAAGCTGCAGGAGGGGGG + Intronic
1097657227 12:62381120-62381142 CAGGCTAATTTGCAGGTGCCTGG + Intronic
1106936044 13:34721312-34721334 AAGGGGAATTTGCACTTGGGAGG + Intergenic
1108899975 13:55390450-55390472 AAGTCAAATTTGCAGGTATTGGG - Intergenic
1109649680 13:65309884-65309906 CAGGCGCTTGTGCAGGTGGTTGG + Intergenic
1111953097 13:94726034-94726056 AAGGAGAATTTGTAGGGGGTGGG + Intergenic
1112325756 13:98441862-98441884 AAAGCCAACTTTCAGGTGGTGGG - Intronic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1117144894 14:52827592-52827614 CATGTGAATTTGCAGGGGGTGGG - Intergenic
1117274167 14:54175736-54175758 GAGGCAAATTTGCATGTGTTAGG - Intergenic
1121526270 14:94621558-94621580 AGGGGGAGTTTGCAGGTGGCAGG + Intronic
1122167786 14:99842604-99842626 AAGGCAAATATTGAGGTGGTGGG + Intronic
1124154065 15:27209706-27209728 AAGGGGAATTTGCTGGTGGCTGG + Intronic
1124824311 15:33078301-33078323 ATGGAGCATGTGCAGGTGGTGGG + Intronic
1128864630 15:71105216-71105238 AACCCCAATTTGCAGCTGGTTGG - Intronic
1130222517 15:82032498-82032520 AAGATGAAGTTGCAGGTGGTAGG - Intergenic
1130830230 15:87591727-87591749 GAAGGCAATTTGCAGGTGGTGGG - Intergenic
1137480454 16:48848239-48848261 AATGAGAATTTGAAGGTTGTTGG + Intergenic
1138187101 16:54985180-54985202 AAGGCAACTTGGCACGTGGTGGG - Intergenic
1140414445 16:74763901-74763923 CAAGCAAATTTGAAGGTGGTGGG - Intronic
1143869248 17:9946359-9946381 AAGACAATTTTGCAGGTGGATGG - Intronic
1151030138 17:70728021-70728043 AAGACAAATTAGGAGGTGGTTGG + Intergenic
1157783510 18:50461280-50461302 GGTGAGAATTTGCAGGTGGTTGG + Intergenic
1157797667 18:50589888-50589910 AATGCAAATTTGCAGGTGAGAGG - Intronic
1159289054 18:66392992-66393014 AAGCAGAAATTGCAGGGGGTAGG - Intergenic
1160418586 18:78728680-78728702 AAGCCCAATTTGAAGCTGGTTGG + Intergenic
1160560985 18:79755642-79755664 AAGGCGATTCTGCGTGTGGTTGG + Exonic
1162481541 19:10929496-10929518 CCGGCGCATTTGCGGGTGGTCGG + Exonic
1162937234 19:13987316-13987338 AAGGTGACTTTGGAGGTGGTAGG - Intronic
1166759146 19:45213563-45213585 AAGGGGGATTTGGAGATGGTTGG - Intronic
928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG + Intronic
930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG + Intergenic
932532251 2:72548216-72548238 AGGAAGAATTTGCAGGTGCTTGG + Intronic
936870076 2:117126106-117126128 AAGGCTATTTTGGTGGTGGTGGG + Intergenic
938398556 2:130968388-130968410 AAGGCTAACTTGCAGGTCTTAGG - Intronic
939685342 2:145191839-145191861 AAGGGGAATTTGCTGTTGCTTGG + Intergenic
941143264 2:161811940-161811962 AAGGTGGGTTTGCAGGAGGTTGG - Intronic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
942119861 2:172765973-172765995 AAGCCCAATTTGCAGAAGGTGGG + Intronic
942240231 2:173956314-173956336 AAGTTGAATTTTCAGGTAGTAGG - Intronic
948231715 2:236353827-236353849 AAGGCTTATTTGCAGGGGGAGGG + Intronic
1169135536 20:3194991-3195013 AAGCGGTATGTGCAGGTGGTTGG - Intronic
1174425806 20:50430862-50430884 AAGGCCAGTTTCCGGGTGGTGGG + Intergenic
1174580523 20:51568311-51568333 AGGGAGAATTGGCAGGGGGTGGG - Intergenic
1175928606 20:62482723-62482745 AAGGCGAGAATGCAGGGGGTGGG - Intergenic
1176054830 20:63139389-63139411 ATGACGAATTTGGAGGAGGTTGG + Intergenic
1177311247 21:19396413-19396435 AAAGGGTATTTGCATGTGGTGGG - Intergenic
949865043 3:8540585-8540607 CAGGCGAACTGGCAGGTGGGAGG + Intronic
952160767 3:30691088-30691110 ATGGGGAATTTTCAGGTGTTGGG + Intronic
952304538 3:32134398-32134420 AAGAGGAACCTGCAGGTGGTAGG - Intronic
953087818 3:39689237-39689259 AATGGGAATCTGCAGGAGGTGGG + Intergenic
953899679 3:46832991-46833013 CAGGAGAATTTCCAGGTGGAAGG - Exonic
955594977 3:60579035-60579057 AAGGACAATTTGCAGGTGCATGG - Intronic
958065114 3:88534844-88534866 AGGGCAAATTTGGGGGTGGTGGG + Intergenic
960035375 3:113097195-113097217 AAGGAGAGGTGGCAGGTGGTGGG - Intergenic
964257621 3:154794873-154794895 AAGGGGGGTTTGCAGATGGTTGG + Intergenic
964470680 3:157051315-157051337 AAGTAGAATTTGCACGTGCTAGG - Intergenic
965676269 3:171200264-171200286 AAGGTCAAGTTGAAGGTGGTTGG + Intronic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
968223791 3:196959460-196959482 AAGGAGAACTTGCAGCTGGTGGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970622920 4:17844663-17844685 AAAGACAATTTGCAGGGGGTTGG + Exonic
977824784 4:101518001-101518023 AAGGGGATTTTACAGGTAGTTGG - Intronic
983926764 4:173411095-173411117 AACGAGCAATTGCAGGTGGTGGG - Intergenic
984536428 4:180981482-180981504 AAGGCCAATTTGCAAGTTTTGGG + Intergenic
985116431 4:186596588-186596610 AAGGGGAGTTTGAAGGGGGTGGG + Exonic
988388804 5:30600503-30600525 AAGGCTAATTTCCAGGTGAGAGG - Intergenic
989338652 5:40349076-40349098 AAGTGGAACTTGCAGGTGGGTGG - Intergenic
993137392 5:83986862-83986884 AAGGAGAATTTCCATGTGGCTGG + Intronic
993353313 5:86876482-86876504 AAGGGGCAGTGGCAGGTGGTTGG + Intergenic
993790893 5:92209905-92209927 AAGGAGAATTTGGAGGTTGGCGG + Intergenic
994303319 5:98172898-98172920 AGGGAGAATTTGTAGGTTGTAGG - Intergenic
996352809 5:122564173-122564195 CAGCCTACTTTGCAGGTGGTTGG - Intergenic
998797919 5:145838420-145838442 AAGTAGAGGTTGCAGGTGGTGGG - Intergenic
999152957 5:149438615-149438637 AAAGCGGGTTTGCAGGAGGTGGG + Intergenic
1001012459 5:168110645-168110667 AAGATGAATTTGCAAGTTGTTGG - Intronic
1001124737 5:169009255-169009277 GAAGCGAATTAGCAGGTTGTTGG - Intronic
1002057798 5:176608832-176608854 AAGAGGTATTTGCAGGTGCTTGG - Intronic
1003968067 6:11272239-11272261 AAGACAGATTTGCAGGTGGAGGG - Intronic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1012458597 6:99434874-99434896 AAGGATAACTTGCAGGTGGTTGG - Exonic
1017363586 6:153605358-153605380 AATGTGCACTTGCAGGTGGTGGG - Intergenic
1024530850 7:50391525-50391547 AAGAAGCATTTGCAGGTGGCTGG + Intronic
1027478155 7:78659630-78659652 AAGGAGAGGATGCAGGTGGTAGG + Intronic
1028023001 7:85801584-85801606 AATGCTAATTTGGAGGTGTTAGG + Intergenic
1030161098 7:106509245-106509267 AAAGCATTTTTGCAGGTGGTTGG - Intergenic
1044870697 8:96616927-96616949 AAAGTGAAATTGCAGGTGGGGGG + Intergenic
1045798440 8:106073866-106073888 AAGGGGATTTTGCAGGTTCTGGG + Intergenic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1053474384 9:38371457-38371479 AAGGCAAAGGTGAAGGTGGTGGG + Intergenic
1058239715 9:102541615-102541637 AAGTCGAATGTGTAGGTGGTAGG - Intergenic
1058940942 9:109812174-109812196 AAGGAGAATTGGCAGGAGTTGGG + Intronic
1061912741 9:133733692-133733714 ATGGCCAGTTTGCAGGTGGGCGG - Intronic
1195139299 X:101942886-101942908 AAGGAGAATTGGCTGGAGGTAGG + Intergenic
1196235138 X:113270968-113270990 ATGGCAATTTTGCAGGAGGTGGG - Intergenic
1197141122 X:123118305-123118327 AAGGAGAGGTGGCAGGTGGTAGG + Intergenic
1200763221 Y:7058771-7058793 TAGAGGAAGTTGCAGGTGGTGGG + Intronic
1201891568 Y:18948493-18948515 AACCCCAATTTGAAGGTGGTTGG - Intergenic