ID: 928031877

View in Genome Browser
Species Human (GRCh38)
Location 2:27786956-27786978
Sequence GTTGTAGCCCTGAGAATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928031877_928031879 14 Left 928031877 2:27786956-27786978 CCCTTCATTCTCAGGGCTACAAC 0: 1
1: 0
2: 0
3: 17
4: 164
Right 928031879 2:27786993-27787015 TCTTTCTTTCTTTTGAGATACGG 0: 5
1: 57
2: 408
3: 4122
4: 27060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928031877 Original CRISPR GTTGTAGCCCTGAGAATGAA GGG (reversed) Intronic
902927612 1:19707113-19707135 GCTGGAGCACAGAGAATGAAGGG - Intronic
905212088 1:36381340-36381362 GTTCTAGCCCAGAGTGTGAAGGG - Intronic
905935509 1:41821067-41821089 GCTGGAGCCCAGAGAAGGAAAGG + Intronic
906042093 1:42795463-42795485 ATTGTAGGTCTGAGAATGCAAGG + Intergenic
907398697 1:54210717-54210739 GTTGTGGCTATGACAATGAAGGG - Intronic
909141632 1:71874499-71874521 TTTGTAGGTATGAGAATGAATGG - Intronic
909233751 1:73125423-73125445 GTTGAAGCACTAAGAATGGATGG - Intergenic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
909482264 1:76138865-76138887 TTTTTACCCCTGAGAATAAAAGG + Intronic
911079651 1:93916103-93916125 GTTTGAGCTCTGAGAATGGACGG - Intergenic
912508996 1:110175656-110175678 GTTGCAGCTCTGAGACTGACTGG - Intronic
915401283 1:155623753-155623775 ATCCTAGCCCTGAAAATGAATGG + Intergenic
916885023 1:169058978-169059000 ATTGTAGCTCTGAGTAAGAAGGG - Intergenic
920528982 1:206687933-206687955 GTTGCAGCCCTGAGAGTTGATGG + Intronic
924011683 1:239672021-239672043 ATTTTATCCCAGAGAATGAAAGG + Intronic
1067145168 10:43689169-43689191 TCTGTAGCCCTGAGAAGGCAGGG - Intergenic
1072573639 10:96679885-96679907 GTTGGAGCAGTCAGAATGAAGGG - Intronic
1072723056 10:97792523-97792545 GTGGTAGCCCTGGGAGTGCACGG + Intergenic
1072937481 10:99727231-99727253 GTTGCAGGACTGAGAAAGAAAGG - Intronic
1073002034 10:100293061-100293083 GTTGTAGCCCTGAAAGGGAAAGG + Exonic
1076375139 10:129978721-129978743 GCTGGAGCCCTGAGAAAGAGAGG + Intergenic
1077942392 11:6856832-6856854 GTTGGAATCCTGTGAATGAACGG - Intergenic
1081357282 11:42126566-42126588 ATTGTAGCCTTTAAAATGAATGG - Intergenic
1082256026 11:50034225-50034247 GCTGTAGTGCTGAGTATGAAAGG - Intergenic
1082809570 11:57471305-57471327 GTTGTTGGCCTGAGAGTCAATGG - Intronic
1082945145 11:58750263-58750285 GTTTGAGCTCTGAGAATGGACGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084199076 11:67543400-67543422 GTAGTAGCCCTGGGACTGAGAGG + Intergenic
1085265187 11:75233583-75233605 GATGTAGCCCAGAGTCTGAATGG - Intergenic
1088165572 11:106932202-106932224 ATTGTAGCCCTGAGCATAACAGG - Intronic
1088672060 11:112151748-112151770 TTTGCAGCCTTGAGAATCAAGGG - Intronic
1089588402 11:119524349-119524371 GCTGGAGGGCTGAGAATGAAAGG + Intergenic
1089714149 11:120340197-120340219 CTTGTATCCCTGAGAATTTAGGG + Intronic
1090402257 11:126456475-126456497 CTTGTAGACCGGAGAAAGAATGG + Intronic
1095396156 12:41764731-41764753 TCTGTAGCCCTGAGCAAGAAAGG + Intergenic
1096094807 12:48927275-48927297 GTTGTAGCTATGGGAATGGAAGG - Intronic
1098205249 12:68102208-68102230 GTTGCAGCCTTGAGTAAGAATGG + Intergenic
1100201275 12:92300154-92300176 GTTGGAGTCCAGGGAATGAATGG + Intergenic
1100383678 12:94085598-94085620 GCTGAAGACCTGAGAATGAAGGG - Intergenic
1101696073 12:107128228-107128250 TGTGCAGCCCTGAGAATGAAGGG - Intergenic
1101853542 12:108423601-108423623 CTAGTAGCCATGAGAATGATGGG - Intergenic
1104078777 12:125412306-125412328 GTTGTATCTCTAAGACTGAAGGG + Intronic
1105263818 13:18799402-18799424 TTTGGAGCCGTGAGATTGAATGG - Intergenic
1106583037 13:31033963-31033985 GCTGAAGCCATGAAAATGAAAGG - Intergenic
1107413055 13:40175249-40175271 GTTGGAACCCTGAGGATGAGGGG - Intergenic
1107685942 13:42898305-42898327 GTTGTTGCCTTGAGTAAGAATGG + Intronic
1109212398 13:59548927-59548949 GTTCTAACTCTGAGAAAGAAGGG - Intergenic
1110640986 13:77823586-77823608 GTTTGAGTTCTGAGAATGAATGG + Intergenic
1111669798 13:91316181-91316203 GTAGTAGACCTGAAAACGAAAGG - Intergenic
1112448261 13:99486840-99486862 GTTGTATCCCTGTAAATGAATGG - Intergenic
1113985655 13:114314092-114314114 GTAATATCCCTGAGAATGTATGG + Intergenic
1114673233 14:24424701-24424723 GTTGTTGGCTTGAGAATGGAGGG + Intergenic
1116441367 14:44957656-44957678 ATTGTTGCTCTGAGGATGAAAGG - Intronic
1116584987 14:46692134-46692156 GTGATAGCCCTGTGAAAGAATGG - Intergenic
1118425992 14:65662709-65662731 ATAGTAGCTCTGAGAAAGAAGGG + Intronic
1118563373 14:67112021-67112043 GTTAAAGCCCTGAAAATTAATGG - Intronic
1119129464 14:72158153-72158175 GTGGGAAGCCTGAGAATGAAAGG + Intronic
1119959322 14:78836610-78836632 TTTGGAGCCCTCAGAAAGAAAGG + Intronic
1120595944 14:86436049-86436071 GTTACAGGCCTAAGAATGAATGG - Intergenic
1120725844 14:87940108-87940130 GTTGTAGATCTGGGAATGAAGGG - Intronic
1121630782 14:95420449-95420471 GTGTTAACTCTGAGAATGAAGGG - Intronic
1126885745 15:53147884-53147906 GTTGTAGCAGTGTAAATGAAAGG + Intergenic
1127484180 15:59404218-59404240 TTTTTTGCCCTGAGAATCAATGG - Intronic
1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG + Intronic
1134467841 16:14495001-14495023 GTGTGAGCCCTGAGAAAGAATGG + Intronic
1137253857 16:46759352-46759374 GTTGTTGCTCAGTGAATGAATGG - Intronic
1137327843 16:47460318-47460340 GTTGTGGCCTTGACAAAGAAAGG + Intronic
1138407678 16:56810969-56810991 TGTTTAGCCATGAGAATGAATGG - Intronic
1138681112 16:58684340-58684362 GTTGGAGCCCTGAGATAGAAAGG + Exonic
1139665570 16:68453160-68453182 ATTGAAGCCATGGGAATGAATGG + Intergenic
1140075775 16:71697716-71697738 GTTGTAGCTCTGGGACTGTATGG - Intronic
1140718739 16:77751095-77751117 GTTGAAGTCCAGAGAATGAGGGG - Intergenic
1141270855 16:82540123-82540145 ACTGTAGCCCTGAGAAGGGAGGG + Intergenic
1142620246 17:1161054-1161076 CTTGTATCCCTGAGAAGGGATGG - Intronic
1142832738 17:2561399-2561421 CTTGTATCTCTGAGAATGAATGG + Intergenic
1147241033 17:39090633-39090655 GGTGTTGTCCTGAGAATTAAGGG + Intronic
1153668785 18:7391031-7391053 GTGGTTTCCCTGAGAAAGAATGG + Intergenic
1153679813 18:7489952-7489974 GTTGTGGTCATGAAAATGAAAGG + Intergenic
1153896105 18:9561995-9562017 GTTTTAGCCCTGATGAGGAAAGG - Exonic
1153992289 18:10411185-10411207 GTGGGAGCCCTGCGAATCAAAGG + Intergenic
1154427237 18:14281335-14281357 TTTGGAGCCATGAGAGTGAATGG + Intergenic
1155735871 18:29221622-29221644 GTTGTAGCCCAGGGAGTGAATGG + Intergenic
1155769948 18:29683703-29683725 GTTGAAGCCGTAAGAATGCATGG - Intergenic
1156705022 18:39870816-39870838 GTTGCATACCTGAAAATGAAAGG - Intergenic
1159579331 18:70217622-70217644 GGTGGAGCACTGAGAGTGAATGG - Intergenic
1160224707 18:77003381-77003403 GCAGTGGCCCTGAGAGTGAAGGG + Intronic
925523578 2:4775357-4775379 GTTGTAGCCATGTGAACAAATGG + Intergenic
926081940 2:9994493-9994515 GTTTAAGCCCTGGGAATGGATGG - Intronic
927101869 2:19794002-19794024 TTTATAGGCCTGGGAATGAAGGG + Intergenic
928031877 2:27786956-27786978 GTTGTAGCCCTGAGAATGAAGGG - Intronic
928151329 2:28832456-28832478 GTTAAAGCCTTGAGAGTGAATGG - Intronic
928577618 2:32671158-32671180 TTTGTAACCCTGAGATGGAAAGG - Intronic
930282978 2:49393505-49393527 GGTGTTGCCCAGAAAATGAAAGG - Intergenic
932783093 2:74575511-74575533 CTTGTAGGTCTGAGGATGAACGG + Exonic
935655211 2:105416856-105416878 GTTGTTTCCCTTAGAATGACAGG + Intronic
935997692 2:108792212-108792234 CTTGTAGCCCAGAGGGTGAAGGG - Intronic
939438549 2:142210931-142210953 GTTTTACATCTGAGAATGAATGG - Intergenic
939834967 2:147118650-147118672 GATGTAAAGCTGAGAATGAAGGG - Intergenic
941563612 2:167080130-167080152 GTTGTAGCATTGAAAATAAATGG + Intronic
941691813 2:168508017-168508039 GTTGTATCACTGAGCATGAAGGG + Intronic
948317053 2:237035955-237035977 TTTGTCACCCTGAGAAAGAATGG + Intergenic
948738807 2:240029617-240029639 GTTGGAGCTCTGGGAATCAATGG + Exonic
1170656480 20:18291599-18291621 TTTAAAGCCTTGAGAATGAACGG - Intronic
1171884651 20:30643139-30643161 TTTGGAGCCGTGAGATTGAATGG - Intergenic
1174428302 20:50448919-50448941 GCTTTAGCCCTGAGAAGGGAGGG - Intergenic
1177115810 21:17084970-17084992 ATTGTATCCCTGAGTATTAAAGG + Intergenic
1177557839 21:22715038-22715060 GTTGTTGCCATGGGAAGGAATGG - Intergenic
1183278191 22:36914580-36914602 GTACTGGCCCTGAGAATGAAAGG + Intronic
949684108 3:6548671-6548693 ATTGGAGGCCTGAGAAAGAACGG + Intergenic
951012199 3:17693746-17693768 GTTTGAGCTCTGAGAATGGATGG + Intronic
951279880 3:20735260-20735282 ATTAAAGCCCTGAGACTGAATGG + Intergenic
952594072 3:34993333-34993355 ATGGTAGCCCTGAGACAGAAGGG + Intergenic
953054957 3:39380706-39380728 GTTGTAGCAGAGAGAATGCATGG + Intergenic
953638008 3:44678856-44678878 ATTGCAGGCCTGAAAATGAAGGG - Intergenic
953779493 3:45854224-45854246 GATGAAACCCTGGGAATGAATGG - Intronic
954283421 3:49600913-49600935 CCTGTAGCCCTGGGAATGAGTGG + Intronic
954656112 3:52195260-52195282 ACTGTAGCTCTGAGAAGGAAGGG + Intergenic
958707513 3:97674562-97674584 GTTGTAGCCCTGTGACTTAGAGG + Intronic
958955528 3:100461874-100461896 GTTGTAGCAATGAGAATAGAGGG - Intergenic
961176868 3:124842868-124842890 ACTGTAGCCCTGAGAGGGAATGG - Intronic
961959538 3:130840175-130840197 TTTGTAGCCACGTGAATGAAGGG + Intergenic
965635508 3:170776344-170776366 GTTATAGCACTGAGAATGGAAGG - Intronic
974913804 4:68154913-68154935 GCAGTAGCCCTGAGAAATAAGGG + Intergenic
977166089 4:93699678-93699700 GGTGGAACCCTGAGTATGAAAGG + Intronic
978386760 4:108183597-108183619 GTTTGACCCCTGAAAATGAAGGG + Intergenic
988127985 5:27067465-27067487 TCTGAAGCCCTGAGAATGAGAGG - Intronic
988985804 5:36617737-36617759 AATGTAGCCCTAAGAATGAGGGG - Intronic
991178960 5:63726186-63726208 TTTACAGCCCTGAGACTGAAGGG - Intergenic
992816445 5:80445131-80445153 TTTGTAGCCCTGAGAATTCAGGG + Intronic
993224229 5:85145226-85145248 GTTATAACCAGGAGAATGAAGGG - Intergenic
995396833 5:111696166-111696188 GTTGTAGTACTGGGCATGAAAGG - Intronic
995559919 5:113369461-113369483 GTTGTATCCATGAAAAAGAATGG - Intronic
996598811 5:125237115-125237137 ATTGTAGCCAAGAGAATGCAAGG - Intergenic
1000130650 5:158294670-158294692 GTTGTTGCCATGCTAATGAATGG - Intergenic
1007257145 6:40537350-40537372 GTTGTGGCCCTGGGAGTGAGGGG - Intronic
1008642865 6:53482791-53482813 ATTGTTGCCCTGAAAATGCAAGG - Intergenic
1008675848 6:53817561-53817583 TTTGTACCCTTAAGAATGAATGG + Intronic
1008838171 6:55863579-55863601 GTTGTAGCAGTGATAATTAAAGG - Intronic
1009398082 6:63225684-63225706 GTTCTAGCTCTGAGAAATAATGG + Intergenic
1010765807 6:79776526-79776548 GCTGAAGCCATGAGAGTGAATGG - Intergenic
1011829296 6:91351876-91351898 GCTGTGGTCCTGAGAATGAGTGG + Intergenic
1013166284 6:107595425-107595447 GTTGTATTCCTTAGAGTGAATGG + Intronic
1014316615 6:119873823-119873845 GCTGTAGCCCTGAGAATAATGGG - Intergenic
1014370468 6:120600880-120600902 GTTCTAACCCTGAGAGAGAAGGG - Intergenic
1014577193 6:123088066-123088088 AATGTACCCCTGAGAGTGAAAGG - Intergenic
1014731938 6:125042505-125042527 TTTGGAGCCTTGAGAAAGAAGGG + Intronic
1017698714 6:157046296-157046318 GTTAGAGCCCTGTTAATGAAAGG + Intronic
1020594811 7:10192624-10192646 GGTGTAGCCTTGAGAAAGATTGG - Intergenic
1024921613 7:54562780-54562802 TTTGTTGCCCTGATCATGAATGG - Intronic
1025208965 7:57009784-57009806 GTTGCAGCCCGGAGTATCAAAGG + Intergenic
1026460571 7:70611387-70611409 GATGTAGCTTTGGGAATGAAAGG + Intronic
1029458674 7:100683509-100683531 GCTGAGGCCCTGGGAATGAAGGG - Intronic
1032705588 7:134418883-134418905 GTAGCATCCCTGAGAAGGAATGG + Intergenic
1033058058 7:138078362-138078384 GTTGTAGCATGGAGAATGGAAGG + Intronic
1037559327 8:20058506-20058528 GTTGTAAGGCTGAGAAGGAAAGG - Intergenic
1041140567 8:54814251-54814273 GTTGTAACTCTGAAAATGAATGG + Intergenic
1041253405 8:55956969-55956991 GCTGTAGCACTGTGAATGAGAGG + Intronic
1042708017 8:71682741-71682763 GTAGAAGCCCTTAGATTGAAAGG - Intergenic
1042816480 8:72882993-72883015 GGTGTAGCCCCGGGAATGGAGGG - Intronic
1043855695 8:85262500-85262522 GTTGGAGCTTGGAGAATGAAGGG + Intronic
1045954916 8:107895229-107895251 GCTGGAGATCTGAGAATGAACGG - Intergenic
1046290214 8:112149405-112149427 GCTGTAGCACTGAGAATTAAGGG - Intergenic
1046815275 8:118576517-118576539 TATGTAGCCCTAAGAATGGAGGG - Intronic
1047199340 8:122751522-122751544 GCAGTCGCCTTGAGAATGAAAGG + Intergenic
1047816914 8:128474312-128474334 GATGTAGCCCTGTGTAAGAATGG - Intergenic
1048085521 8:131173937-131173959 TGTGTAGCCCTTAGAATAAAAGG + Intergenic
1048881427 8:138875706-138875728 GTTGTAGGCCTGAGAGGGGATGG - Intronic
1049006261 8:139857533-139857555 GTGGCAGCCGTGAGAGTGAACGG - Intronic
1052913496 9:33905539-33905561 GATGTATCCCTGAGAATGCAAGG - Intronic
1053104864 9:35400755-35400777 GAGGAAGCCTTGAGAATGAATGG + Intronic
1055081592 9:72272918-72272940 GTTTAAGCCCTGAGAGTGATGGG + Intergenic
1058564738 9:106270514-106270536 GTTGTGGCCATGAAAATGGATGG - Intergenic
1058911073 9:109520551-109520573 GTTGAAGCCCAGAGAAGGAAAGG - Intergenic
1186728969 X:12387810-12387832 ATTGTATGCCTGAGAAAGAATGG - Intronic
1186947546 X:14585625-14585647 GTTGTAAACCTGAGTATGCAGGG - Intronic
1188602488 X:31986045-31986067 GTTGGAGCCCCTTGAATGAAGGG + Intronic
1191773792 X:64790193-64790215 GTTGTTGCTTTGAGAAGGAAAGG - Intergenic
1192133472 X:68574748-68574770 CTTGTGGCCCTGAGAAGGGAAGG - Intergenic
1194716187 X:97289618-97289640 GTTGTAGCTCTGAGAACCATGGG + Intronic
1198595518 X:138231369-138231391 GTTTGAGCTCTGAGAATGGACGG + Intergenic
1199668054 X:150117718-150117740 ATTGAAGCCCAGAGAAGGAAAGG - Intergenic
1200017145 X:153174926-153174948 CTTGTAGCCCTAGAAATGAAGGG + Intergenic