ID: 928032457

View in Genome Browser
Species Human (GRCh38)
Location 2:27793272-27793294
Sequence GCATTAACACTGCTGGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928032457 Original CRISPR GCATTAACACTGCTGGGTAA AGG Intronic
901775832 1:11559958-11559980 GCATGAACACTTTTGGGTGAAGG - Intergenic
902342067 1:15790350-15790372 GCACTACCACAGCTGGCTAATGG - Intergenic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
908741690 1:67335362-67335384 TCATTAACAGTGCTGTGTTAGGG + Intronic
910996899 1:93115576-93115598 GCAGTAACACTGCTGGACATTGG - Exonic
915723787 1:158003146-158003168 GGCTTGACAATGCTGGGTAATGG - Intronic
917746418 1:178012795-178012817 CCATGTATACTGCTGGGTAATGG - Intergenic
922503556 1:226113695-226113717 GCAACAACAATGCTGGGAAAGGG - Intergenic
922607054 1:226896036-226896058 GCAGTCACACTGCTGGGAAGTGG + Exonic
1066123918 10:32320091-32320113 GTGTTAACACGTCTGGGTAAAGG + Intronic
1066221326 10:33337418-33337440 CCACTCACAGTGCTGGGTAATGG + Intergenic
1070651127 10:78237144-78237166 GCTTGAACACTGCTGGGGGAGGG + Intergenic
1073540362 10:104312698-104312720 GAATTAACCCTGGTGGGCAAAGG + Exonic
1076081607 10:127586698-127586720 GCATTTACACTATTGGTTAAGGG - Intergenic
1076234912 10:128856080-128856102 GCACAAACACTGCTGGGAAGTGG + Intergenic
1078769591 11:14336110-14336132 CCATTGACACTGCTGGGAGAAGG - Intronic
1080735644 11:35011187-35011209 GCCTTAAAACTACTGGATAATGG + Intronic
1080821429 11:35810469-35810491 TCATAAGCACTGCTGGATAAAGG - Exonic
1083908798 11:65692922-65692944 GCAGTCACACTGCTGGGAAGTGG + Intergenic
1088688309 11:112303716-112303738 GCTTTAAGACTGCTTGGTAAGGG - Intergenic
1095991827 12:48040081-48040103 GTATTCAGACTCCTGGGTAAGGG + Intergenic
1096765426 12:53884682-53884704 GCATTGTCACTGTTGGGTTAAGG + Intergenic
1099361903 12:81713580-81713602 GAATTGGCATTGCTGGGTAAAGG - Intronic
1102374758 12:112413061-112413083 CCATTAACACTGCTGGGGATTGG + Intronic
1105738477 13:23297293-23297315 CCTCTAACACTGCTGGGTTAGGG - Intronic
1105793914 13:23831880-23831902 GCATTTTCAATGCTGGGTATAGG + Intronic
1106704159 13:32262731-32262753 GCATGAACACTGCTGGTGGATGG + Intronic
1107091096 13:36480959-36480981 GCATTAACACTGATAAATAAGGG - Intergenic
1113074012 13:106450571-106450593 GCACTGCCACTGCTGGGTAACGG - Intergenic
1117613308 14:57506251-57506273 GCATTCACCTTTCTGGGTAAGGG - Intergenic
1125473783 15:40030153-40030175 GCATCAAAACTGCTGGGTGTTGG + Intronic
1125520552 15:40345768-40345790 ACATTAAGACTTCTGGGTTATGG + Intergenic
1128536247 15:68492885-68492907 GCATGAACACTGATGGGTCACGG - Intergenic
1130845074 15:87736490-87736512 GCATGAACACATCTGGGTATTGG + Intergenic
1131350411 15:91694508-91694530 GCCAAAACACTGCTGGGGAATGG + Intergenic
1134385963 16:13772683-13772705 TCGTTAACAATTCTGGGTAAAGG + Intergenic
1138736513 16:59257392-59257414 GCAGTCACACAGTTGGGTAAGGG + Intergenic
1140485734 16:75291674-75291696 GCAGCAACCCTGCTGGGAAAAGG + Intergenic
1144504101 17:15815563-15815585 ACAATGACAATGCTGGGTAAGGG + Intergenic
1144633845 17:16891192-16891214 ACAATGACAATGCTGGGTAAGGG + Intergenic
1145167960 17:20631070-20631092 ACAATGACAATGCTGGGTAAGGG + Intergenic
1147378762 17:40039605-40039627 GTATAAACACTGATGGGAAAGGG - Intronic
1150161102 17:62898830-62898852 GCAATGACACTTGTGGGTAAAGG - Intergenic
1152177928 17:78800160-78800182 GACTTAACACTACTGGTTAAAGG - Intronic
1154380868 18:13848717-13848739 GCCTCAGCACTGTTGGGTAACGG - Intergenic
1155277631 18:24204057-24204079 GGGTTAAAACTGCTGGGTCAAGG + Intronic
1157850862 18:51049303-51049325 GGATTAACACTGCAGAGTAATGG + Exonic
1162823508 19:13237242-13237264 GCCTTCACCCTGCTGGGTACTGG - Intronic
1166489796 19:43248726-43248748 GCATTCCTACTGTTGGGTAAAGG - Intronic
927059311 2:19400201-19400223 TAATTAAAACTGCTGGGTAATGG - Intergenic
927849950 2:26492765-26492787 ACATTAACACTGCAGAGAAAGGG + Intronic
928032457 2:27793272-27793294 GCATTAACACTGCTGGGTAAAGG + Intronic
933459290 2:82560182-82560204 GCATCAACACTGGAGGGGAAAGG + Intergenic
935310402 2:101777575-101777597 GCATTTACACTGCGTGGTCAGGG - Intronic
937815444 2:126245392-126245414 GCATTAAATCTCCTGGGAAAGGG - Intergenic
938641478 2:133285408-133285430 GCTTTAAAACTGCTTGGCAATGG + Intronic
938664719 2:133522826-133522848 ACATTAACACTACTCGGTTATGG - Intronic
943776585 2:191773010-191773032 TCTTTAACACTGCAGAGTAATGG - Intergenic
943867510 2:192945986-192946008 ACATTAGCACTGCTTTGTAATGG + Intergenic
944505582 2:200407365-200407387 GAATTAACTTTGCTGAGTAAGGG - Intronic
948838112 2:240636024-240636046 GCATAAACACTCCTGGATATGGG - Intergenic
1176712867 21:10269954-10269976 GCATAAACATTCCTGGGTGAAGG - Intergenic
1176713200 21:10326206-10326228 GCATAAACATTCCTGGGTGAAGG + Intergenic
1180600334 22:17011193-17011215 GCAATAACACTGCTTAGTGATGG - Intergenic
1183781348 22:40000995-40001017 GCATTAAGGCTGGTGGATAATGG + Intronic
949448628 3:4162444-4162466 GCCTTGCCACTGCTGGGTAAAGG - Intronic
950252256 3:11475532-11475554 GCATGTAAACTGCTGGGAAAAGG + Intronic
952203545 3:31156183-31156205 GCATTCACACTGAGGGGTCAGGG - Intergenic
952814396 3:37434678-37434700 CTATTAACATTGCTGTGTAATGG - Intronic
955475088 3:59328358-59328380 GAATTAACTCTGGTGGGTGATGG - Intergenic
959197861 3:103209398-103209420 CCTTTAGCACTGCTGGGTTAGGG + Intergenic
961508428 3:127387190-127387212 GGATGGACACTGCTGGGTGAGGG - Intergenic
962569519 3:136698624-136698646 ACAATCCCACTGCTGGGTAAAGG + Intronic
963178311 3:142325071-142325093 GCAATTCCACTGCTGGGTATAGG - Intronic
964197544 3:154082047-154082069 TCTTTAGCACTGCTGGGTTAGGG - Intergenic
967308334 3:188081777-188081799 GCACTGACAATGCTGGGTATGGG + Intergenic
968522088 4:1038579-1038601 GCAGTAGCCCTGCTGGGTCAGGG + Intergenic
969266008 4:6064536-6064558 CAATTAAAACTGCTGCGTAATGG - Intronic
971620494 4:28849067-28849089 GCATTAGCTCTGCTGGGGGATGG + Intergenic
972329423 4:38050810-38050832 GCATTAACAGTCCTGGATGATGG + Intronic
980752897 4:137115698-137115720 GCAAAACCACTGCTGGGGAATGG - Intergenic
981329674 4:143494331-143494353 GCAATCTCACTGCTGGGTATAGG + Intergenic
984074992 4:175165672-175165694 GCATGAACAATGCTGGAAAAAGG - Intergenic
984498574 4:180530621-180530643 GAATTAACTGTGCTGGGTCAGGG - Intergenic
985008219 4:185555871-185555893 GCAATCCCACTGCTGGGTAGTGG - Intergenic
986397602 5:7345569-7345591 GCACAGCCACTGCTGGGTAAAGG + Intergenic
990632070 5:57681225-57681247 GCTCCATCACTGCTGGGTAATGG + Intergenic
993526373 5:88970920-88970942 GGATTAACATTGGTGGTTAATGG - Intergenic
994101590 5:95899271-95899293 GAACTAACACAGCTAGGTAAAGG + Intronic
998633912 5:143931427-143931449 GCAACACCACTGCTGGGGAATGG - Intergenic
1000288006 5:159844553-159844575 GTTTTAACACTGCAGGGTTAGGG - Intergenic
1003063675 6:2883419-2883441 GCAATCCCACTACTGGGTAATGG + Intergenic
1004806689 6:19210779-19210801 GCATTCACACTGCTGGGGGAGGG + Intergenic
1007219887 6:40270113-40270135 GCAATAACAAAGCTGGGAAAGGG + Intergenic
1007730380 6:43942001-43942023 GCACAGACACTGCTTGGTAATGG - Intergenic
1008638649 6:53438025-53438047 GTTTTATCACTACTGGGTAATGG + Intergenic
1011495850 6:87936111-87936133 GCAGTAAAAATGCTGGGTGAGGG + Intergenic
1013751776 6:113415452-113415474 TTAGTAATACTGCTGGGTAAGGG - Intergenic
1013864509 6:114679113-114679135 GCATTAACAATGGAGGTTAAAGG + Intergenic
1016080842 6:139853495-139853517 TAGTTAACTCTGCTGGGTAAAGG - Intergenic
1018717000 6:166541112-166541134 GCATTAACACAGCTGCATGATGG - Intronic
1020664428 7:11022304-11022326 AGATTAAAACTGCTGGGAAAAGG - Intronic
1021054614 7:16032555-16032577 GCTTTCACACTGCTGAGTATAGG - Intergenic
1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG + Intergenic
1023489686 7:40725718-40725740 GTATTAACTCTGCTGAGAAACGG - Intronic
1024646895 7:51378447-51378469 GCACTACCACAGCTGGTTAATGG + Intergenic
1030400947 7:109049423-109049445 GAATGAATTCTGCTGGGTAAGGG - Intergenic
1030727325 7:112940438-112940460 GCAGTACTACTGCTGGGCAAAGG + Intergenic
1036393561 8:8346930-8346952 GCATTCACACTGCTGGCTCTTGG + Intronic
1038261532 8:26000269-26000291 GCATTTGCACTGCTTTGTAATGG - Intronic
1039380682 8:37082064-37082086 GCATTCACACTACTGAGAAAAGG - Intergenic
1042128466 8:65562827-65562849 TCATTAACACTGCTTGATAGTGG - Intergenic
1046941780 8:119938660-119938682 GCATTACCACACCTGGCTAATGG + Intronic
1052992112 9:34524526-34524548 GCCCTCACCCTGCTGGGTAATGG - Intergenic
1053227665 9:36374794-36374816 ACATTAATCCTGCTGGGTAAGGG + Intronic
1059624741 9:116050835-116050857 GGATTAACACTGCTATGAAAAGG + Intergenic
1059671562 9:116497013-116497035 GAAATAACACTCCTGGGTGAAGG - Intronic
1185937505 X:4275431-4275453 GAAATAACACTGATGGGAAAAGG - Intergenic
1187245724 X:17551448-17551470 ACATCAAGACTGCTGGGGAAGGG - Intronic
1187660025 X:21534443-21534465 GCATTCACATTACTGGGTATAGG - Intronic
1189425951 X:40900118-40900140 GCATCAATACTGCTGAGCAATGG - Intergenic
1190488944 X:50961513-50961535 GCATAAAGACAGCAGGGTAAAGG - Intergenic
1200002204 X:153067856-153067878 CCCTTAACACTGCTGCGTTAGGG - Intergenic
1200005529 X:153082169-153082191 CCCTTAACACTGCTGCGTTAGGG + Intergenic
1200082290 X:153583791-153583813 GTATTTCCACTGCTGGGTATAGG - Intergenic
1200158341 X:153990353-153990375 GCAGTTCCACTGCTGGGTATAGG + Intergenic