ID: 928040359 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:27869835-27869857 |
Sequence | AAACTCTGCTTCACAAAGAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 352 | |||
Summary | {0: 2, 1: 26, 2: 40, 3: 50, 4: 234} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
928040358_928040359 | 10 | Left | 928040358 | 2:27869802-27869824 | CCATAATCTCGTTTTGGTTGCTG | 0: 5 1: 22 2: 10 3: 16 4: 100 |
||
Right | 928040359 | 2:27869835-27869857 | AAACTCTGCTTCACAAAGATAGG | 0: 2 1: 26 2: 40 3: 50 4: 234 |
||||
928040356_928040359 | 20 | Left | 928040356 | 2:27869792-27869814 | CCAGTCTACTCCATAATCTCGTT | 0: 4 1: 12 2: 22 3: 30 4: 105 |
||
Right | 928040359 | 2:27869835-27869857 | AAACTCTGCTTCACAAAGATAGG | 0: 2 1: 26 2: 40 3: 50 4: 234 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
928040359 | Original CRISPR | AAACTCTGCTTCACAAAGAT AGG | Intronic | ||