ID: 928040359

View in Genome Browser
Species Human (GRCh38)
Location 2:27869835-27869857
Sequence AAACTCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 2, 1: 26, 2: 40, 3: 50, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928040356_928040359 20 Left 928040356 2:27869792-27869814 CCAGTCTACTCCATAATCTCGTT 0: 4
1: 12
2: 22
3: 30
4: 105
Right 928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG 0: 2
1: 26
2: 40
3: 50
4: 234
928040358_928040359 10 Left 928040358 2:27869802-27869824 CCATAATCTCGTTTTGGTTGCTG 0: 5
1: 22
2: 10
3: 16
4: 100
Right 928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG 0: 2
1: 26
2: 40
3: 50
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928040359 Original CRISPR AAACTCTGCTTCACAAAGAT AGG Intronic