ID: 928040610

View in Genome Browser
Species Human (GRCh38)
Location 2:27872833-27872855
Sequence CACCCATCAAATAAGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928040608_928040610 15 Left 928040608 2:27872795-27872817 CCTAGCTTAATGAATGTATATGA 0: 1
1: 0
2: 0
3: 12
4: 194
Right 928040610 2:27872833-27872855 CACCCATCAAATAAGAAACATGG 0: 1
1: 0
2: 2
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928040610 Original CRISPR CACCCATCAAATAAGAAACA TGG Intronic
901346431 1:8548116-8548138 TACCCTTCATATAAGAAAGACGG + Intronic
901778677 1:11578066-11578088 CAGCCACCAAATAAAAGACAGGG - Intergenic
902106951 1:14045593-14045615 AATCCATCAAATTGGAAACAGGG - Intergenic
905619081 1:39425653-39425675 AACCCATAAAATAAGACACAGGG - Intronic
906468956 1:46110909-46110931 GACCCATAAAAAAAGAAAGATGG + Intronic
907098198 1:51801164-51801186 CACCCATGAAATGATAAAAAAGG - Intronic
907994705 1:59618130-59618152 CCACCATCAAATAAGAAAGTTGG + Intronic
908665811 1:66489260-66489282 AACCCAGAAAAGAAGAAACAGGG + Intergenic
910692398 1:89977959-89977981 CCCCCACCAAAAAAGAAAAAAGG + Intergenic
911553490 1:99313609-99313631 CATGCTTCAAATAAGAAAAAAGG - Intergenic
912162705 1:107005861-107005883 CACACATCAAATAATTAAAAGGG - Intergenic
915615404 1:157034040-157034062 CATCCCTCAAATAAGAAGCTTGG - Intronic
916334976 1:163660918-163660940 CACCCAGCAAACAAGTAACATGG - Intergenic
918617014 1:186556473-186556495 CTTCCAACAAACAAGAAACAAGG - Intergenic
918628253 1:186683275-186683297 AACCCACCAAAGAAGAAACGAGG - Intergenic
918862176 1:189843923-189843945 CTCCCATCAAAGAAAAGACAAGG - Intergenic
921986983 1:221322824-221322846 CACCCATAAAATAAGAATGCTGG - Intergenic
924465594 1:244296568-244296590 CACACAGCAGATAAGACACAGGG + Intergenic
1063103694 10:2973944-2973966 CAACCCTCAAATATAAAACAGGG - Intergenic
1063504999 10:6589840-6589862 CACTCACCAAATAAGAAAAAAGG - Intergenic
1064617959 10:17182223-17182245 CACCCAACCTAGAAGAAACAAGG + Intronic
1067924040 10:50489670-50489692 CACTCATTAAAAAATAAACATGG + Intronic
1068581076 10:58740518-58740540 CACCCATCAAATAAGATCCAGGG - Intronic
1068806067 10:61195124-61195146 CACACAGCTAATAAAAAACAGGG - Intergenic
1072316828 10:94211458-94211480 CATCTATCAAATAAGAGAAATGG + Intronic
1072902640 10:99422287-99422309 CACCGGCCATATAAGAAACATGG - Intronic
1073167287 10:101467263-101467285 CATCAATCAAATCAGAAAGAAGG - Intronic
1073299096 10:102459966-102459988 CAGACATTAAATGAGAAACAAGG - Intergenic
1073805736 10:107095806-107095828 CTCCCATCCAAGGAGAAACACGG + Intronic
1073942148 10:108711753-108711775 AACCTATAAAATAAAAAACAAGG + Intergenic
1073960125 10:108916695-108916717 CAACGATCAAATAAGTAACATGG - Intergenic
1075448059 10:122527661-122527683 CATCCAGGAAATAGGAAACATGG - Intergenic
1085677226 11:78534476-78534498 CACCTAAAAAGTAAGAAACATGG + Intronic
1088413112 11:109557869-109557891 CAGCCAACAAATATGAAAAATGG - Intergenic
1088551518 11:111018225-111018247 CACCCAACATATAGGAATCAAGG + Intergenic
1088594983 11:111434803-111434825 CACCCATCCAGGAAGAAATAAGG + Intronic
1090609384 11:128456620-128456642 CACACATCAAATATGGGACAAGG - Intergenic
1091761682 12:3091650-3091672 CATTCATCAAATAAGAACAAAGG + Intronic
1092529248 12:9331113-9331135 CTCCCATCAATTAAGAAGAAAGG - Intergenic
1092753084 12:11737131-11737153 GAACCATCAATTAAGAAACAAGG + Intronic
1093109541 12:15132834-15132856 ACCCCATCAAAGAAGATACACGG - Intronic
1097618541 12:61912177-61912199 GACCCAGCTAATAAGAACCAGGG + Intronic
1098073203 12:66698619-66698641 CACCGAACAAACAAGAAACAGGG - Intronic
1099922377 12:88975027-88975049 CACCCATAACATTAGAAAAATGG - Intergenic
1101010488 12:100444334-100444356 TACCCTTCAAGTAAGAAAGAAGG - Intergenic
1101975755 12:109356973-109356995 CACACATCAAGAAAGAAGCACGG - Intronic
1102841047 12:116122565-116122587 CATCAAACAAATAAGAATCATGG + Intronic
1103140361 12:118542698-118542720 CACACATCTAATAAGTGACAAGG + Intergenic
1104199052 12:126569744-126569766 TGCTCATCAGATAAGAAACATGG - Intergenic
1108508782 13:51136296-51136318 CACCCCCAAAATAAGAAGCAAGG + Intergenic
1108534767 13:51363475-51363497 CAATCAGCAAATGAGAAACATGG + Intronic
1109238453 13:59852925-59852947 CACCCACACTATAAGAAACATGG + Intronic
1109535669 13:63715255-63715277 CATCCACAAAATAAGAAAAATGG - Intergenic
1110379695 13:74836116-74836138 CACACCTCAAATAAGAAGCTAGG + Intergenic
1111111451 13:83715574-83715596 CACCAATCTAATATTAAACATGG + Intergenic
1111774131 13:92637873-92637895 AAAGCATCAAATGAGAAACATGG + Intronic
1112911308 13:104487801-104487823 CTCCCATCCAGTTAGAAACAAGG - Intergenic
1115191118 14:30747966-30747988 AACTTACCAAATAAGAAACAGGG + Intergenic
1115410710 14:33071213-33071235 CAACCATCAAATAATATGCATGG + Intronic
1115427751 14:33280261-33280283 CACCCAACTTATAAGAAACTTGG + Intronic
1115804840 14:37039086-37039108 CAGCTATCAAGTAAGGAACAAGG + Intronic
1117092647 14:52266705-52266727 CTTCTATCAAATAAGAATCATGG + Intergenic
1117623799 14:57614999-57615021 CATCCATCAAATAAGAAAGTAGG + Intronic
1118361009 14:65056512-65056534 CACCCATCAAATTGGCAAAAAGG - Intronic
1118539780 14:66809677-66809699 CACTGAACAAATAAGAAATAAGG - Intronic
1122336867 14:100996404-100996426 CAGCCAACAAACAAGAAAAAAGG - Intergenic
1125320909 15:38487176-38487198 CACACATCAAAAGGGAAACAAGG + Exonic
1125378373 15:39058937-39058959 CACCCAGCAATGATGAAACATGG + Intergenic
1125757883 15:42077097-42077119 CACCCATCAAAGAAAAGTCAAGG + Intronic
1126241688 15:46452245-46452267 TAACCCTCAAATAAAAAACAAGG - Intergenic
1126308203 15:47285391-47285413 CTCCAATAAAGTAAGAAACAAGG - Intronic
1126311357 15:47320404-47320426 CACTGATAAAATAAGGAACAGGG - Intronic
1127707569 15:61562335-61562357 GACCCATTAAATCAGAATCAAGG - Intergenic
1132379256 15:101355292-101355314 GAACCATGAAATAAGATACATGG + Intronic
1133123721 16:3630117-3630139 CACACAACAAAAAACAAACAAGG - Intronic
1134087678 16:11369559-11369581 AACACATCAAATTAGAAAGAGGG - Intronic
1135193527 16:20375365-20375387 CACCTCTCAAAGAAGTAACAAGG + Intronic
1138395150 16:56698362-56698384 AACCCATCAAAAAAGACACCCGG + Intronic
1138445555 16:57061067-57061089 CACACAGCAGATAAGAAAGAAGG - Intronic
1138910585 16:61393276-61393298 CACGCATTATAAAAGAAACATGG - Intergenic
1139107945 16:63851060-63851082 TTTCCAGCAAATAAGAAACAGGG - Intergenic
1140156372 16:72431596-72431618 CACCAATGAAATAAGGAAAAAGG - Intergenic
1140699167 16:77565454-77565476 TTCCCATCAAACAAGAGACAAGG + Intergenic
1141264451 16:82483452-82483474 CACCCATCATATCAGGAACTAGG + Intergenic
1144284787 17:13763385-13763407 CACTCCTATAATAAGAAACAAGG + Intergenic
1144997317 17:19279174-19279196 CTCCAAACAATTAAGAAACAGGG - Intronic
1146289402 17:31597073-31597095 GACCCATCAACTGAGCAACAGGG + Intergenic
1146807591 17:35877755-35877777 CATCCATCAGAGAAGAAATAAGG - Intronic
1150419811 17:65022915-65022937 CAACTGTCAATTAAGAAACATGG + Intronic
1150616158 17:66773816-66773838 GACCCTTCAAATCAGACACACGG - Intronic
1151408654 17:73906272-73906294 AACCAATCAAATCTGAAACACGG + Intergenic
1151910616 17:77080402-77080424 CACCCAGGAAACAAGAAATATGG - Intergenic
1152140905 17:78536046-78536068 AACGCATCAAACAAGACACACGG - Intronic
1153527577 18:6012475-6012497 CACTAATCAAAAGAGAAACATGG - Intronic
1153958102 18:10115601-10115623 AACCCCTCAAATTATAAACATGG + Intergenic
1158234163 18:55294406-55294428 CACCCAATAAATAGGAAACAAGG + Intronic
1158695358 18:59698221-59698243 CCCCCATCAAATGAGACACGTGG + Intergenic
1159133345 18:64306779-64306801 CACCCCAAAAATAAGAGACAAGG + Intergenic
1159257365 18:65964314-65964336 CACTCATGAAATAAAAAAAATGG + Intergenic
1159806687 18:72965460-72965482 CATCCATCAAACAACAAACGTGG + Intergenic
1161384546 19:3984008-3984030 CTCCCATGAATTAAGAAACCAGG + Intronic
1162283334 19:9717958-9717980 CTCCCAACAGAGAAGAAACAGGG + Intergenic
1164313665 19:24068113-24068135 CATCCATCACCTAAGAAACGTGG + Intronic
1164585445 19:29469159-29469181 CTCCCCTAAAATGAGAAACAAGG + Intergenic
1164629255 19:29751087-29751109 CACCCATCAAAAGAAAAAGATGG + Intergenic
1164986168 19:32650249-32650271 CACCATTCAAAAAAGAAACATGG + Intronic
1166124519 19:40705767-40705789 CACCCAGCTAATTAGAGACAGGG - Intronic
1168404493 19:56103670-56103692 TACCCATCACAGCAGAAACAGGG + Intronic
926513067 2:13806768-13806790 TACCCATGAAATAAGTAAAAAGG + Intergenic
927317712 2:21704484-21704506 CACTCATCCAATAATAAACATGG + Intergenic
928040610 2:27872833-27872855 CACCCATCAAATAAGAAACATGG + Intronic
928499047 2:31868520-31868542 CACACATCACATAAAAAACTGGG + Intronic
928725595 2:34170508-34170530 CTGCCATCTAATACGAAACATGG - Intergenic
930893294 2:56416417-56416439 CACTCACCAAAGTAGAAACAAGG - Intergenic
930932986 2:56911155-56911177 TACTCATCCAATAACAAACAAGG - Intergenic
933682504 2:85114519-85114541 CACCCATCAAATAAGCCATCTGG + Intergenic
935741996 2:106157622-106157644 TACCCATCAATTGAGAAACAGGG + Intronic
937591902 2:123624140-123624162 GATCCAACAAATAAAAAACACGG - Intergenic
937785854 2:125896846-125896868 CAACCGTCAAGTAAGAATCAAGG - Intergenic
938976137 2:136480497-136480519 CACCCAGCCAAGGAGAAACAGGG - Intergenic
941189500 2:162361507-162361529 CCTCCATCCATTAAGAAACATGG - Intronic
942487587 2:176455863-176455885 CACCCATCAAATCACACACCAGG + Intergenic
943110592 2:183600003-183600025 CACCCATGAAATAACATTCAAGG - Intergenic
944216510 2:197261810-197261832 CACATATCAAACAAGAGACAGGG + Intronic
944774147 2:202945002-202945024 AAACCATGAAATAGGAAACATGG + Intronic
946592018 2:221260595-221260617 CATCTATAAAATAATAAACATGG + Intergenic
947420831 2:229940269-229940291 CACCCTCCAAAAAAGAAACAAGG - Intronic
947981615 2:234415251-234415273 CTGCCATCAAAGAAGAACCATGG + Intergenic
948226379 2:236312736-236312758 CAGCCATCAAATAAAAAAACTGG + Intergenic
1169891642 20:10459726-10459748 CAGCCATCAAGGAACAAACAAGG - Intronic
1172773587 20:37395192-37395214 CACCCAGCAAACCAGAGACAGGG - Intronic
1175054086 20:56182082-56182104 CACCCACCTGATTAGAAACATGG + Intergenic
1178549898 21:33528013-33528035 CACATATCCAATAAGCAACATGG + Intronic
1178796206 21:35746608-35746630 CACCCATAAAATAAGAATGCTGG - Intronic
1179127069 21:38599895-38599917 CACCCAACATATGAGAAACTGGG - Intronic
1179355459 21:40654639-40654661 CAGCCATGAACCAAGAAACAGGG - Intronic
1185116435 22:48940888-48940910 CACCCGTCAAACACGTAACAGGG - Intergenic
949563498 3:5224026-5224048 CATCCATAAAATAAAAAATAAGG - Intergenic
950173279 3:10853792-10853814 CATCCATCAAACATGAATCAAGG - Intronic
950587959 3:13909468-13909490 CACCCATCACCTGAGAAACCTGG + Intergenic
951415345 3:22416496-22416518 CACTAATTAAATAAGAAATATGG + Intergenic
953674191 3:44987130-44987152 CACCCTTCATATAAGAAACAAGG + Intronic
954977571 3:54711025-54711047 TTGCCATCAAATAACAAACAGGG + Intronic
956448797 3:69352580-69352602 TACCCATCAAGGAAGAAAAATGG + Intronic
957235864 3:77590081-77590103 AATGCATCAAATAACAAACAAGG - Intronic
957535606 3:81499010-81499032 AACTCTTCAAATAAGCAACATGG - Intronic
958188085 3:90149042-90149064 CACACATCATCTAAGAAAGAGGG + Intergenic
958410605 3:93810870-93810892 CACACATCATCTAAGAAAGAGGG + Intergenic
962122532 3:132577425-132577447 CAATGATAAAATAAGAAACATGG - Intronic
962629899 3:137265175-137265197 CTCTCTTCAAATAAGAAAGAGGG + Intergenic
962841504 3:139237100-139237122 CACCCATCTAATTTGAAAGAAGG - Intronic
963960658 3:151305409-151305431 CAACCAACAACAAAGAAACATGG - Intronic
964105430 3:153034596-153034618 AACCAATCAAATAAGCAGCAGGG + Intergenic
964572995 3:158131251-158131273 TTCCCAGCAAATAAGAAATATGG - Intronic
965330626 3:167370341-167370363 GACAGCTCAAATAAGAAACATGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966636099 3:182135393-182135415 CACCCAGCAAATTGGAACCATGG + Intergenic
966889271 3:184395007-184395029 CACCCATCAGCTGAGAAGCATGG - Intronic
967523197 3:190460046-190460068 CATCACTCAAAGAAGAAACATGG + Intergenic
969268501 4:6081933-6081955 CATCTATCAAATGAGAATCACGG + Intronic
969403036 4:6969708-6969730 CTCCCCTCAAAAAAAAAACAGGG - Intronic
969863130 4:10053247-10053269 CAACCAACAAACAACAAACAGGG + Intronic
971402487 4:26288924-26288946 CATCCTTCAAATGAGAAACTTGG + Intronic
971479357 4:27100366-27100388 CACTTATCATATAAGAAGCAGGG + Intergenic
972700012 4:41485148-41485170 AACCATCCAAATAAGAAACATGG - Intronic
973199079 4:47479265-47479287 CATCCATCCAATAAGGAGCAAGG + Intergenic
973871981 4:55175983-55176005 AATTCATCAAATTAGAAACAGGG + Intergenic
974366877 4:60961687-60961709 CACCCAGCAAGAAAGAAGCAGGG + Intergenic
974685818 4:65227202-65227224 CACACATAAATTAAGAATCAAGG + Intergenic
977127110 4:93183848-93183870 AACTCATCAGGTAAGAAACAAGG + Intronic
978240229 4:106506284-106506306 CACCCTTGAAATATGAAGCAAGG + Intergenic
978416678 4:108484178-108484200 CACCTATCAAACAAGAAAGGTGG + Intergenic
980170201 4:129280416-129280438 CACTAATGAAATAAGATACATGG + Intergenic
980473076 4:133274358-133274380 CCCCCATCCACAAAGAAACAGGG + Intergenic
981739397 4:147986178-147986200 CATCTATGAAATAAGAAAAACGG + Intronic
984828475 4:183949856-183949878 CACACATCAAAGCAGAAAAATGG - Intronic
986039210 5:3970974-3970996 CACTCCAAAAATAAGAAACATGG - Intergenic
986442262 5:7792820-7792842 CATCCATAAAAGAAGAAGCATGG + Intronic
987044142 5:14090760-14090782 CACCCAACAAATATGGAATAGGG - Intergenic
987561559 5:19530253-19530275 CACTCATCATATATAAAACATGG + Intronic
987766066 5:22231393-22231415 TACCCATTAAATTAGAAAGAAGG - Intronic
988367537 5:30320089-30320111 CAGCCATCAAATATGAATAAGGG + Intergenic
989192993 5:38689477-38689499 CAGTCATCAAATCAGAAACTGGG + Intergenic
991267212 5:64734977-64734999 CTTCCATAACATAAGAAACAAGG - Intronic
992071509 5:73153264-73153286 AACCCATCACATAAAAAATAAGG - Intergenic
992129853 5:73681382-73681404 CACCCATAAAATAAAAATAATGG - Intronic
993262916 5:85683553-85683575 CACACATCAAATAACATAAAAGG - Intergenic
993963508 5:94331844-94331866 CACACAGAAAATCAGAAACATGG + Intronic
994181066 5:96766788-96766810 TGTTCATCAAATAAGAAACAAGG + Intronic
994602116 5:101919589-101919611 AATCCTTCAAATAAGAACCAAGG + Intergenic
994765679 5:103914059-103914081 CACCCATAAAATTATAAAAATGG + Intergenic
995071935 5:107933087-107933109 CATACCTCAAATAAGAAACCTGG - Intronic
995186899 5:109281211-109281233 CACCCATCACCTGAGAAACCAGG + Intergenic
998659587 5:144221155-144221177 CAGACATCTAATAAGCAACATGG - Intronic
998938888 5:147259638-147259660 CACCCATTAACTAAGGAATAGGG + Intronic
999085192 5:148882007-148882029 AACCAATCACATAAGAAAAATGG - Intergenic
999649477 5:153751153-153751175 CATACAACCAATAAGAAACAAGG + Intronic
999859468 5:155630120-155630142 CACTCATCAAAGAAGATATATGG - Intergenic
1001014977 5:168132431-168132453 CTCCCATCAAAAAAGAAAAGAGG + Intronic
1002692066 5:181056955-181056977 CAGCCATCCCATAAGAAAAATGG - Intronic
1003079089 6:3006512-3006534 CACCCATCAAATCAGAGAGAAGG + Exonic
1003734927 6:8867679-8867701 AACCCATTAAATAAGAGAAATGG - Intergenic
1004373974 6:15076026-15076048 CACCCACCCAAGAAGATACAGGG + Intergenic
1005287603 6:24345504-24345526 CACCCCACTAAGAAGAAACAAGG + Intronic
1005791327 6:29304572-29304594 CACTTATCAAATAAGAAGGAAGG - Intergenic
1007309434 6:40933774-40933796 CATCCATAAAATAGGGAACACGG + Intergenic
1009660766 6:66607479-66607501 CATCCATCACAGAAGAAAGATGG + Intergenic
1010048884 6:71480610-71480632 CACTCATCTAGTAAGCAACAGGG + Intergenic
1010076660 6:71805992-71806014 AAGCCATTAAATAAAAAACATGG - Intergenic
1011060360 6:83259262-83259284 TAAGCAGCAAATAAGAAACATGG + Intronic
1017478647 6:154826838-154826860 CACGTATCAAATAAGTAAAATGG + Intronic
1018282477 6:162201758-162201780 CACACATAAAATAAGAAAAGAGG + Intronic
1019081959 6:169439123-169439145 AACCCATCGAATAAGCATCATGG - Intergenic
1019694426 7:2437248-2437270 CAGCCATCACACAAGAGACAGGG - Intergenic
1020551635 7:9614368-9614390 AAGTAATCAAATAAGAAACATGG + Intergenic
1021538702 7:21733080-21733102 CTCCCAGCAAAGAAGAAGCAGGG + Intronic
1029507696 7:100972252-100972274 CACACAGCAAATAATGAACACGG + Intronic
1029959201 7:104671378-104671400 CCCCCATTAAAATAGAAACAGGG + Intronic
1030375718 7:108751116-108751138 CCACCATCAAATAATAATCATGG + Intergenic
1030507621 7:110444823-110444845 CCCCCTTCAAAAAAGAAAAAAGG + Intergenic
1031962761 7:128004749-128004771 CAACCAGGAAATAAGACACACGG - Intronic
1033612390 7:142976378-142976400 CCCCCATAAGATCAGAAACAAGG + Intergenic
1034980422 7:155472286-155472308 CACGCAGCAGAGAAGAAACAGGG + Intergenic
1035309800 7:157959506-157959528 CACCCAACAACAAAGAAGCAAGG + Intronic
1037021514 8:13977170-13977192 CACCCAGCAAAGAAGAGGCAAGG - Intergenic
1037079092 8:14760850-14760872 CACACATGAAAAAGGAAACAGGG - Intronic
1038243928 8:25836378-25836400 CACCCATCAGATAAGCAACCCGG + Intergenic
1039122414 8:34162015-34162037 CAAACATTAAATAAGAAACTAGG - Intergenic
1042653042 8:71063964-71063986 GACCCATAAAAGAAGACACAAGG - Intergenic
1043307489 8:78814485-78814507 CTCCCATCAAATAAAAACCCAGG - Intergenic
1043985292 8:86688016-86688038 CAACCTTCAAAAAACAAACAGGG + Intronic
1045001396 8:97881253-97881275 CATCCATAAAATAAGAGGCATGG - Intronic
1045920604 8:107524383-107524405 CACTCATCAAGGGAGAAACATGG - Intergenic
1047257448 8:123225992-123226014 CAACCATCAAAGTAGTAACAGGG + Intronic
1048649914 8:136464031-136464053 ACCACATCAAGTAAGAAACACGG + Intergenic
1054796331 9:69305913-69305935 CATCCAGCAGACAAGAAACATGG - Intergenic
1055200926 9:73660925-73660947 CAACCAACAAATAAGCAATAGGG + Intergenic
1055509198 9:76978272-76978294 CACCAATGAAATAAGAACAAAGG + Intergenic
1056226264 9:84498296-84498318 CATCCCTCAAACAAGAAAGATGG - Intergenic
1056572461 9:87828036-87828058 CACCTGGCAAATAAGGAACATGG - Intergenic
1186320070 X:8414463-8414485 CAATCAGCAATTAAGAAACAAGG - Intergenic
1186681490 X:11879255-11879277 CACCCTTCAAGTAAGAAATCAGG - Intergenic
1187030678 X:15485071-15485093 CAGCCATCAAAACAGAAACCAGG + Intronic
1187299410 X:18033225-18033247 CAACCAACAAATAACAATCAGGG - Intergenic
1187500100 X:19832576-19832598 CACCCATCCCATGAGAGACACGG + Intronic
1189699085 X:43697425-43697447 CATCCATCAAACAATAACCAAGG - Intronic
1194269218 X:91789253-91789275 CAACCATCAAATAACAATTAAGG - Intronic
1196866327 X:120074397-120074419 CACTCAGCAAATAAGGAAAAAGG - Intronic
1196876771 X:120161884-120161906 CACTCAGCAAATAAGGAAAAAGG + Intronic
1197686772 X:129448152-129448174 CTACAAACAAATAAGAAACATGG + Intronic
1199180543 X:144848799-144848821 CCCCTCTCAAATGAGAAACATGG - Intergenic
1200586436 Y:5010242-5010264 CAACCATCAAATAACAATTAAGG - Intronic