ID: 928044362

View in Genome Browser
Species Human (GRCh38)
Location 2:27913020-27913042
Sequence CTTTAGATGCTGAAGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928044362_928044364 13 Left 928044362 2:27913020-27913042 CCAAGGACCTTCAGCATCTAAAG 0: 1
1: 0
2: 1
3: 18
4: 150
Right 928044364 2:27913056-27913078 GTGTTTTTCAAACTCTTTGATGG 0: 1
1: 0
2: 6
3: 34
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928044362 Original CRISPR CTTTAGATGCTGAAGGTCCT TGG (reversed) Intronic
900567613 1:3341322-3341344 CTTCAGAGGCTGCAGGCCCTGGG + Intronic
902839959 1:19068319-19068341 CTGCAGATGCTGAAGGTCACTGG + Intergenic
906328112 1:44861288-44861310 CTTTAGATACAGAGGCTCCTGGG + Intronic
907125003 1:52041976-52041998 CTTTAGATTCAGAAAGACCTAGG + Intronic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
916832423 1:168506517-168506539 TTTTAGATGTTGAACGTCCCAGG + Intergenic
919292974 1:195657212-195657234 CTTTAATTGCTGAATGCCCTGGG + Intergenic
919897392 1:202017920-202017942 CTTTAGAAGCTGAAGAGGCTGGG - Intergenic
919915162 1:202134421-202134443 GTTTAGATGATGACGGTCCCTGG + Exonic
920437004 1:205953514-205953536 CTATAGAAGCTGAGGGGCCTGGG - Intergenic
924850987 1:247830309-247830331 CTCTGGATGCAGAAGGGCCTTGG - Intergenic
1063413367 10:5853731-5853753 CTTTACACGCAGAAGGTCCTGGG - Intergenic
1067396582 10:45925328-45925350 CTATAAAAGCTGTAGGTCCTAGG + Intergenic
1067864900 10:49894432-49894454 CTATAAAAGCTGTAGGTCCTAGG + Intronic
1070668961 10:78364768-78364790 CTTCAGAAGATGTAGGTCCTCGG + Intergenic
1072304215 10:94091695-94091717 ATTTTTATGCTGAAGCTCCTTGG - Intronic
1072310471 10:94149527-94149549 CTTGAGATTCTGATGGTTCTGGG - Intronic
1074775588 10:116766209-116766231 CTTTGGACACTGAAAGTCCTGGG + Intergenic
1080005347 11:27400397-27400419 ATTTAGGTGCTGTAGGTCTTTGG - Intronic
1080128667 11:28767225-28767247 CTTTGTTTGCTCAAGGTCCTTGG - Intergenic
1083025926 11:59550649-59550671 CTTTACACGCAGAAGGTCCTGGG - Intergenic
1083025964 11:59551007-59551029 CTTTACACGCAGAAGGTCCTGGG - Intergenic
1083512684 11:63226653-63226675 CTATATTTGCTAAAGGTCCTAGG + Intronic
1084182136 11:67452126-67452148 CTGAGGATGCTGGAGGTCCTGGG - Exonic
1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG + Intergenic
1086797125 11:91119973-91119995 CTTCATATGCAGAAAGTCCTGGG + Intergenic
1087855429 11:103086935-103086957 CTTTAGAATCAGAAGGACCTGGG + Intronic
1089279953 11:117366972-117366994 CTTGAGATGCTCAAGGACCTGGG + Intronic
1090290913 11:125543899-125543921 CCTCAGATGCTGAAGCTCCACGG + Intergenic
1090909241 11:131104152-131104174 CTTGAGGAGCTGCAGGTCCTGGG - Intergenic
1091802106 12:3330864-3330886 CTTGAGATGCTGAATGGCATGGG - Intergenic
1095769557 12:45937898-45937920 CTTTAGATCCTGAAGATTCCTGG - Intronic
1100309844 12:93384047-93384069 CTTCAGAGGCTGTAGGTCCTTGG - Intronic
1100452425 12:94720320-94720342 CCTTGGCTGCTCAAGGTCCTGGG - Intergenic
1104660708 12:130609827-130609849 CCGCAGATGCTGAAGCTCCTGGG - Intronic
1105857938 13:24388190-24388212 TTTTTGATGCTGATGCTCCTAGG - Intergenic
1109050665 13:57477247-57477269 CTTTATATCTTTAAGGTCCTAGG - Intergenic
1110946849 13:81432301-81432323 ATTTACATTCTGAAAGTCCTAGG + Intergenic
1112379818 13:98878190-98878212 ATTGAGATGCTGAAAGTCCTGGG - Intronic
1117689729 14:58294113-58294135 TTTTAGATGCTGAAATTTCTGGG - Intronic
1118331637 14:64820044-64820066 CTTCTGAAACTGAAGGTCCTGGG - Intronic
1121069211 14:91001096-91001118 TTTGAGCTCCTGAAGGTCCTAGG - Exonic
1121336064 14:93078183-93078205 CTTGAGAGGCTCAAGGTCTTAGG + Intronic
1125598256 15:40901067-40901089 CTTTAGATGTGGAAGGGCTTGGG + Intronic
1129122457 15:73408943-73408965 CTTTAGATGTTAAAGGGCCAGGG + Intergenic
1130870378 15:87966784-87966806 CTTTAGCTGCCAAAAGTCCTAGG - Intronic
1130981238 15:88813045-88813067 CTTAATATGCTGATGGACCTTGG + Intronic
1131117284 15:89803175-89803197 CTTGAGATGCTGAAGGTACCTGG - Intronic
1135846163 16:25920510-25920532 CTTCAGAGGCTGAAGTCCCTGGG - Intronic
1139033996 16:62920903-62920925 TATTTGATGCTGTAGGTCCTTGG + Intergenic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1142504196 17:352505-352527 CTTTAGAAGCAGCAGGACCTGGG + Intronic
1143354677 17:6317499-6317521 CTCTAGAGCCTGAATGTCCTTGG + Intergenic
1143572204 17:7766456-7766478 CTCCAGGTTCTGAAGGTCCTTGG - Exonic
1145906354 17:28518268-28518290 CTTTAGATGCAAATGGTCCCAGG + Intronic
1147386011 17:40082700-40082722 CTTTACATGCAGAAGGTCCTAGG - Intronic
1149951490 17:60992442-60992464 CTCTAGATGCAAAAGGTCATTGG + Intronic
1151006258 17:70439751-70439773 CTGTAGATGCTGCTGGTCCATGG - Intergenic
1153014769 18:573658-573680 CTTTAGATCCTGACGTTCCAGGG + Intergenic
1153434636 18:5056364-5056386 CTTTAGCTTCTGAAAGTGCTGGG - Intergenic
1154019138 18:10647555-10647577 CTTTACAATCTGAAAGTCCTGGG + Intergenic
1154185075 18:12175669-12175691 CTTTACAATCTGAAAGTCCTGGG - Intergenic
1156332675 18:36139179-36139201 CTTTAGAAGGTGAAGGTCTGGGG + Intronic
1156585616 18:38427821-38427843 CTTTAGAAGCTGGATGACCTTGG - Intergenic
1159193516 18:65080938-65080960 CCTTAGAAGCTGAATGTTCTAGG - Intergenic
1162088359 19:8261991-8262013 CTTTAGCTGCAGAGGTTCCTGGG - Exonic
1162095897 19:8309772-8309794 TTTTAGCTGCTGAAGGGTCTGGG + Intronic
1165190712 19:34060966-34060988 CTTTGTATTCAGAAGGTCCTTGG - Intergenic
1165227799 19:34366506-34366528 CTCAAGATACTCAAGGTCCTGGG - Intronic
924970465 2:122252-122274 CTCTAGATTCTGATGGTCCTGGG - Intergenic
927047849 2:19297987-19298009 CTCTAGATTCTGAAGATGCTGGG + Intergenic
927591854 2:24363451-24363473 CTAAGGATGATGAAGGTCCTGGG - Intergenic
928044362 2:27913020-27913042 CTTTAGATGCTGAAGGTCCTTGG - Intronic
928813905 2:35265661-35265683 CTTTAGGTGCAGAAAGTCATGGG - Intergenic
931684988 2:64785119-64785141 CTTTAGCCTCTGAAGGTCCAGGG + Intergenic
933652233 2:84858782-84858804 CTTTACACACTGAAGGTCCTGGG + Intronic
934249646 2:90338966-90338988 CTTTAGATTTTGAAGATCATAGG - Intergenic
936166890 2:110128599-110128621 CTTTAAATCTTCAAGGTCCTGGG + Intronic
936561590 2:113543192-113543214 CTTGAGATGCTGCTGGACCTGGG - Intergenic
936623322 2:114122445-114122467 CCTTAGACTCTCAAGGTCCTAGG + Intergenic
940059899 2:149553469-149553491 CATCATATGCAGAAGGTCCTGGG + Intergenic
941830314 2:169951146-169951168 ATTGAGATGATAAAGGTCCTAGG - Intronic
942959608 2:181814102-181814124 CTTTATATGTTGATGTTCCTTGG - Intergenic
1170080536 20:12469749-12469771 CTTAAGATGCTGAATCACCTGGG - Intergenic
1170370627 20:15644253-15644275 GTTTAGATGCTGGAGGTGGTGGG - Intronic
1170398676 20:15956709-15956731 CTTCAGATCCTGAAGGTCTGGGG - Intronic
1171351719 20:24507635-24507657 CTTTGGCTGCTGAAGGTCTGTGG + Intronic
1172198566 20:33109100-33109122 CTTGAGATCCTGTAGGACCTCGG + Intronic
1179633277 21:42691764-42691786 CTTTGGATGGTGATGGTCATGGG - Intronic
1180799863 22:18626708-18626730 CCTGAGAAGCTGAAGGTCTTGGG - Intergenic
1181221852 22:21368558-21368580 CCTGAGAAGCTGAAGGTCTTGGG + Intergenic
1181364310 22:22363370-22363392 CTTTTGATGCTGAAGGTGCGTGG + Intergenic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1181637241 22:24180198-24180220 CCTGAGAAGCTGAAGGTCTTGGG + Intergenic
953403897 3:42650884-42650906 TTTTAGTTGCTAGAGGTCCTAGG - Intergenic
955894728 3:63687046-63687068 CTCTAGATGCTAAAGGTGCTTGG - Intergenic
956030424 3:65031144-65031166 CATTAGCTGTTGGAGGTCCTAGG - Intergenic
956841628 3:73145383-73145405 TTTCAGTTGCTGTAGGTCCTTGG + Intergenic
959645513 3:108695321-108695343 CTTTAGGTGCTGAAGGTAATGGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961471006 3:127112605-127112627 CTTCAGAAGGTGAGGGTCCTGGG + Intergenic
964174086 3:153804566-153804588 CTTTAAATACTGGAGGTCCTTGG + Intergenic
964815205 3:160710175-160710197 CTTTAGAGACAGAAGGTCTTGGG + Intergenic
965535710 3:169822112-169822134 CTTTAAACGCTGAATCTCCTGGG - Exonic
966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG + Intergenic
967042092 3:185703227-185703249 ATTTATATGTTGAAAGTCCTTGG - Intronic
968842821 4:3020606-3020628 CCTTAAATGCTGGAGTTCCTGGG + Intronic
969569269 4:7999007-7999029 CTGTAGATGTTAAAGGTCCCAGG + Intronic
970359917 4:15298615-15298637 CTGGAGATGCTCAGGGTCCTTGG - Intergenic
974512897 4:62868030-62868052 ATTTAGAGGCTCAATGTCCTTGG - Intergenic
974686486 4:65237948-65237970 ATTTAGAAGCTGAATGACCTGGG - Intergenic
976546282 4:86339160-86339182 CTTTAGACCCTGAATGTCCCTGG - Intronic
977604020 4:98964104-98964126 CTATAGATGCTGCAGAGCCTGGG - Intergenic
983165880 4:164477100-164477122 CTATATATGCTCAAGGCCCTAGG + Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
985949066 5:3209535-3209557 CTTAAGAGCCTGAAGGTCTTTGG + Intergenic
988838506 5:35059168-35059190 CTTCAGTTGCTGAAGGTTTTAGG + Exonic
989047458 5:37286793-37286815 TTATAGATGCTGAAAGTACTTGG - Intergenic
994323796 5:98425435-98425457 CCTTAGTTGCTGAAGGTCTGTGG + Intergenic
1000488825 5:161883249-161883271 CTTTAGCTGCGGAAGATGCTTGG - Intronic
1000523178 5:162322317-162322339 CTTTAGATGCTGCTGGACCAAGG + Intergenic
1003223774 6:4186752-4186774 CTTCAGCCGCTGCAGGTCCTGGG + Intergenic
1004670049 6:17787129-17787151 CTTCAGCTGCTGTATGTCCTAGG + Intronic
1005361873 6:25038586-25038608 CTTTAGTTGCTGAAGGCCTCAGG + Intronic
1007969568 6:46037115-46037137 CTTCTTATGATGAAGGTCCTTGG - Intronic
1009812717 6:68689381-68689403 CTTTAGATGGTGCAGTTCATAGG + Intronic
1010575669 6:77527124-77527146 GGTTAGATACTGAAGGCCCTGGG - Intergenic
1011236101 6:85218747-85218769 CTTTGTCTGCTTAAGGTCCTAGG - Intergenic
1012604952 6:101146025-101146047 GCTTAGAGTCTGAAGGTCCTGGG - Intergenic
1016693892 6:146970143-146970165 CTTTAGAGGCTGTATGTTCTGGG - Intergenic
1017349064 6:153418556-153418578 TTTTAGATTCTGAAGCTCCACGG - Intergenic
1023340389 7:39213313-39213335 CTGTGGATGCTGAAGTACCTGGG + Intronic
1025790058 7:64680653-64680675 CTTTAGACCCTGAAGGGCCAGGG + Intronic
1026413934 7:70157662-70157684 CTTCAGATCCTGAAGTGCCTGGG - Intronic
1031231532 7:119113992-119114014 CTATAGTTGCTGAAGGCCTTGGG + Intergenic
1031725459 7:125232112-125232134 CTCTACATGCTGAAGTCCCTGGG - Intergenic
1031918072 7:127581807-127581829 CTAGAGATACTGAAAGTCCTGGG - Exonic
1033539442 7:142343167-142343189 CTATAGATGCTGAGTGGCCTGGG + Intergenic
1034076292 7:148234592-148234614 TGTTAGATGCTGAAGCTCCTTGG + Intronic
1034834478 7:154338977-154338999 CGTTAGATGCTGAATAACCTCGG - Intronic
1035715881 8:1754604-1754626 CTTTAGATGCTGAAGTGTTTTGG - Intergenic
1036827451 8:11988256-11988278 CTTTAGAGGGTGAAGACCCTTGG - Intergenic
1038195335 8:25361780-25361802 CTTTGGATGCTGAACGGCATGGG - Intronic
1039426687 8:37492348-37492370 CTTTAGATGCAGTGGTTCCTCGG + Intergenic
1039565927 8:38552687-38552709 CTTTAGAAGCAGAAGGTGTTAGG - Intergenic
1045945951 8:107796343-107796365 CCTTATATTCTAAAGGTCCTTGG + Intergenic
1047801302 8:128313448-128313470 CTTTAGAGTCTGAAAGACCTGGG + Intergenic
1049662379 8:143825306-143825328 CTCTGGAGGCTGAAGGACCTGGG - Intronic
1049891094 9:72126-72148 CTTGAGATGCTGCTGGACCTGGG + Intergenic
1049985162 9:943604-943626 CCTTAAATTCTGAAGGTCATGGG + Intronic
1050230719 9:3523716-3523738 TTTTGGATGGTGAAGCTCCTGGG - Intronic
1053469742 9:38337852-38337874 CTGCAGATCCTGAAGGTCCCAGG + Intergenic
1053732535 9:41073181-41073203 CTTGAGATGCTGCTGGACCTGGG + Intergenic
1054695898 9:68358394-68358416 CTTGAGATGCTGCTGGACCTGGG - Intronic
1056867897 9:90246162-90246184 CTTTAGTTCTTGCAGGTCCTGGG + Intergenic
1059120011 9:111633122-111633144 CTTCATATGCTGAAGTGCCTTGG - Intronic
1059416269 9:114164422-114164444 CTTTAGCTGCAGATGGTCTTTGG + Intronic
1060102329 9:120851489-120851511 CTGTAGAGGCTGAAGGTCTGAGG + Intergenic
1060895303 9:127213162-127213184 CTTTAGATTCTGACGTTCATGGG + Intronic
1061441742 9:130609417-130609439 CTTCAGATGCTTATGGTCTTGGG + Intronic
1185505387 X:629761-629783 CTTTATTTGCAGAAGGTCCTTGG + Intronic
1187367109 X:18674929-18674951 CTTTACACGCAGAAGGTCCTGGG - Intergenic
1188278492 X:28232944-28232966 CTTTTGAAACTGAATGTCCTAGG + Intergenic
1189854339 X:45208932-45208954 CTATATTTGCTCAAGGTCCTAGG + Intergenic
1190847178 X:54204858-54204880 CTTTAGAAGCTGAAGGGATTGGG - Intronic
1191624817 X:63259119-63259141 CTTTTGACTCTGAAGGTCCTCGG - Intergenic
1192276961 X:69642198-69642220 CTTTAGAGGCTGAAAGGCCTGGG + Intronic
1194727840 X:97419031-97419053 TTTGAGGTGCTGAAGGACCTTGG - Intronic
1194931651 X:99895729-99895751 CTCTAAAAGCTGAGGGTCCTGGG + Intergenic
1200024663 X:153247249-153247271 CTTCACATGGTGAAGGGCCTGGG - Intergenic