ID: 928051475

View in Genome Browser
Species Human (GRCh38)
Location 2:28001032-28001054
Sequence CACATCTGGCACTAAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928051475_928051479 13 Left 928051475 2:28001032-28001054 CCAAGATCTTAGTGCCAGATGTG 0: 1
1: 0
2: 9
3: 41
4: 268
Right 928051479 2:28001068-28001090 GGATGTCATTGCTTTTATTTAGG 0: 1
1: 0
2: 5
3: 76
4: 508
928051475_928051478 -8 Left 928051475 2:28001032-28001054 CCAAGATCTTAGTGCCAGATGTG 0: 1
1: 0
2: 9
3: 41
4: 268
Right 928051478 2:28001047-28001069 CAGATGTGCTTGTTGCTACTGGG 0: 1
1: 4
2: 24
3: 80
4: 315
928051475_928051477 -9 Left 928051475 2:28001032-28001054 CCAAGATCTTAGTGCCAGATGTG 0: 1
1: 0
2: 9
3: 41
4: 268
Right 928051477 2:28001046-28001068 CCAGATGTGCTTGTTGCTACTGG 0: 1
1: 4
2: 28
3: 68
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928051475 Original CRISPR CACATCTGGCACTAAGATCT TGG (reversed) Intronic
900751729 1:4401913-4401935 TAAATGTGGCACTCAGATCTGGG - Intergenic
901287678 1:8094069-8094091 CAAATCTGGCAGTGAGGTCTAGG + Intergenic
902115509 1:14117660-14117682 CAGATCTGGGATTCAGATCTGGG - Intergenic
902836688 1:19051937-19051959 CACACCTGGCACCCAGATGTTGG - Intergenic
904974801 1:34447773-34447795 CACTTGTGGCACCAACATCTGGG + Intergenic
905366176 1:37452841-37452863 CTCATCTGTCATTAAGCTCTTGG - Intergenic
906570398 1:46833110-46833132 CACACCTAACACTCAGATCTTGG - Intergenic
906705184 1:47889479-47889501 CACATCTGGCAATAAGATTCAGG - Intronic
907379030 1:54070048-54070070 CAGAACTGGCACTAACAGCTGGG + Intronic
908011273 1:59779718-59779740 CACTTCCGGCACCCAGATCTTGG - Intergenic
909799777 1:79791964-79791986 CACAGCTGGCATTATGATCTTGG - Intergenic
910683144 1:89888577-89888599 CATATCTGGCATCCAGATCTTGG + Intronic
911091003 1:94016814-94016836 CATATCTAGCACTCAGACCTTGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913468305 1:119165615-119165637 CACATCTGGAAATTAGATCTTGG + Intergenic
914257572 1:145973160-145973182 CACACCTAGCACCCAGATCTTGG - Intronic
916532993 1:165676213-165676235 CACACCTGGCACTCAGATCTTGG + Intronic
918823565 1:189291675-189291697 CACATCAGGCACTGAAATTTTGG + Intergenic
919214736 1:194537441-194537463 CACATCTAGCACCAAGACTTTGG - Intergenic
923112771 1:230905319-230905341 CACATCTGACACTAACTTCCTGG - Intergenic
924389813 1:243541572-243541594 CACATCTAGCAGCCAGATCTGGG - Intronic
1063239930 10:4158453-4158475 CAAAGCTGGAACTAAGACCTTGG + Intergenic
1063251880 10:4282618-4282640 CACATCTGGCTCAGGGATCTGGG + Intergenic
1064179745 10:13103786-13103808 CAGATCTGGGAATAAAATCTAGG + Intronic
1065151146 10:22824684-22824706 CACTTCAGGCACTAAAATCGTGG + Intergenic
1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG + Intronic
1067533092 10:47088525-47088547 CAAATGTGGCACTCTGATCTTGG + Intergenic
1070242925 10:74701391-74701413 CACAGCTGCCACCCAGATCTTGG + Intronic
1071175390 10:82920567-82920589 CACACCTGTAACTCAGATCTTGG + Intronic
1073523588 10:104157837-104157859 CACATCTGGTATCCAGATCTTGG + Intronic
1074083019 10:110182699-110182721 TGCATCTGGCACTAAGAGATTGG - Intergenic
1074339919 10:112618436-112618458 CCTATCAGGCTCTAAGATCTTGG - Intronic
1074643289 10:115413816-115413838 CATACCTAGCACCAAGATCTTGG - Intronic
1077244930 11:1532149-1532171 CACATGTGGCACAAAGAACAGGG + Intergenic
1080158333 11:29139935-29139957 CACACCTGACACTCAGGTCTTGG - Intergenic
1080293540 11:30698931-30698953 CACATGCAGCACTCAGATCTTGG + Intergenic
1080851706 11:36076074-36076096 CACACCTAGCACCCAGATCTTGG - Intronic
1081036995 11:38160942-38160964 TACATCTAGCACACAGATCTTGG + Intergenic
1082037319 11:47655740-47655762 AACATTTTGCACTGAGATCTTGG - Intergenic
1082833272 11:57635057-57635079 CCCATCTGGCCCTTAAATCTCGG + Intergenic
1083178053 11:60965183-60965205 CACACCAGGCTATAAGATCTGGG + Intergenic
1083416276 11:62527850-62527872 CACATCAGGCATGGAGATCTTGG + Exonic
1083416310 11:62528051-62528073 CACATCAGGCATGGAGATCTTGG + Exonic
1083416377 11:62528435-62528457 CACATCAGGCATGGAGATCTTGG + Exonic
1083416412 11:62528636-62528658 CACATCAGGCATGGAGATCTTGG + Exonic
1083416449 11:62528837-62528859 CACATCAGGCATGGAGATCTTGG + Exonic
1083416483 11:62529059-62529081 CACATCTGGCATGGAGACCTTGG + Exonic
1083416544 11:62529443-62529465 CACATCGGGCATGGAGATCTTGG + Exonic
1083416688 11:62530433-62530455 CACATCAGGCATGGAGATCTTGG + Exonic
1083416758 11:62530817-62530839 CACATCAGGCATGGAGATCTTGG + Exonic
1083416870 11:62531564-62531586 CACATCAGGCATGGAGATCTTGG + Exonic
1083416929 11:62531948-62531970 CACATCAGGCATGGAGATCTTGG + Exonic
1085259514 11:75196209-75196231 CTCATCTGACACTAACTTCTGGG + Intronic
1086031637 11:82365796-82365818 CACAACTGGCACTGAGATCTTGG + Intergenic
1086222586 11:84467066-84467088 CGTATCTAGCACAAAGATCTTGG + Intronic
1086502483 11:87467530-87467552 CGCAGCTGGCACTCAGATCTGGG + Intergenic
1086547205 11:88011826-88011848 CACATCTGGGACTCAGGTATAGG + Intergenic
1088774057 11:113064979-113065001 CACATCTAGCACCCATATCTTGG + Intronic
1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG + Intergenic
1090505213 11:127304564-127304586 CACATCTAGCTTTTAGATCTAGG - Intergenic
1091148985 11:133308660-133308682 CACACCCAGCACCAAGATCTTGG + Intronic
1093164069 12:15785648-15785670 CACACCTAGCACCCAGATCTTGG + Intronic
1094426009 12:30317856-30317878 CACATTAGACACTAAGCTCTGGG + Intergenic
1094538594 12:31344052-31344074 CAAAGCTGGCTCTCAGATCTTGG - Intergenic
1094778177 12:33757109-33757131 CACACCTGGCACCTAGAGCTTGG - Intergenic
1095166032 12:38973104-38973126 CACACTTAGCACTCAGATCTTGG - Intergenic
1096040683 12:48513647-48513669 CACATCTAGCACCCAAATCTTGG + Intronic
1096564044 12:52461176-52461198 CACATCTTGTACCTAGATCTTGG - Intergenic
1096972482 12:55678847-55678869 CACATCCAGCATTCAGATCTTGG + Intergenic
1098961091 12:76740197-76740219 CACAACTGCCCCTGAGATCTGGG - Intergenic
1101569579 12:105940788-105940810 CACTGCAGGCACTAAGAGCTTGG - Intergenic
1102008184 12:109602047-109602069 CACATCTGGCCCCAGGATTTTGG - Intergenic
1102125763 12:110479213-110479235 CACACCTAGCACCCAGATCTTGG - Intronic
1102580640 12:113884606-113884628 CACACCTGGCACCCAGATCTTGG + Intronic
1102638138 12:114342470-114342492 GACATTTGGCCCGAAGATCTTGG - Intergenic
1105755178 13:23457266-23457288 CACACCTCGCACTGAGTTCTAGG + Intergenic
1107194585 13:37634414-37634436 CACATCTGTCAGCAACATCTGGG + Intergenic
1107265372 13:38546869-38546891 CACACTTGGCACCCAGATCTTGG + Intergenic
1107496394 13:40929589-40929611 CACTTCTGACACTAAAAGCTTGG - Intergenic
1109653734 13:65363554-65363576 TACATCTAGCACTTAGATTTTGG - Intergenic
1113323479 13:109261422-109261444 CACCTCTAGCACAAAGATCATGG + Intergenic
1115389729 14:32841407-32841429 CACACCTAACACTAAAATCTTGG - Intergenic
1115644545 14:35359293-35359315 CACATCTAGCACCCAGATCTTGG + Intergenic
1116098325 14:40401929-40401951 GACAGCTAGCACTAAGAGCTAGG - Intergenic
1116904432 14:50391338-50391360 CACAGCTGGCTCTAAGCTATGGG - Intronic
1116991366 14:51280380-51280402 CACATCTAGCTCTATGATCTTGG - Intergenic
1117060558 14:51958323-51958345 CACATTTGGCATCTAGATCTTGG - Intronic
1117287871 14:54304901-54304923 CACATCTAACACCCAGATCTTGG - Intergenic
1117414552 14:55481696-55481718 CACATCTAGCACCCAGATCTTGG + Intergenic
1117551974 14:56845691-56845713 CTCATCTGGCACAAAAATCAAGG - Intergenic
1118168853 14:63365131-63365153 CACATCTAGCATCCAGATCTTGG + Intergenic
1118400089 14:65371823-65371845 CACATCTAGCACCCAGATCTCGG - Intergenic
1118758853 14:68865437-68865459 CACGTCCGGCACAAATATCTTGG - Intergenic
1120617854 14:86730171-86730193 CAAATCTGGCACCTAGATCTTGG + Intergenic
1121234610 14:92383224-92383246 CACAGCTGGAAGTAAGATATGGG + Intronic
1122827884 14:104380172-104380194 CCCAGCTGGCACTTTGATCTTGG - Intergenic
1122878953 14:104681417-104681439 CACATCTGGCTCTCAGAGCTGGG + Intergenic
1123798209 15:23794876-23794898 CACATACAGCACCAAGATCTTGG + Intergenic
1124398669 15:29329556-29329578 CACACCTGGCACTGAGATTTTGG + Intronic
1124475127 15:30026490-30026512 CACATCAGACAATAAGATGTGGG - Intergenic
1125722672 15:41852718-41852740 CACATCTGACACTGAGTGCTGGG + Exonic
1125820046 15:42621837-42621859 CACATCTAGCACCCAGAACTTGG - Intronic
1126676949 15:51167836-51167858 TACATCTAGCACTTAGATCTTGG - Intergenic
1126722734 15:51599312-51599334 CACAACTGGCATCTAGATCTTGG - Intronic
1127065871 15:55237628-55237650 CACACCTGGCTCTAAGTTATTGG + Intronic
1127158806 15:56158217-56158239 CAAATCTGGAACTCAGATCTGGG - Intronic
1127322499 15:57860911-57860933 CACACCTAGCACCCAGATCTTGG - Intergenic
1127993870 15:64140904-64140926 CACATTTGGCACCCAGATCTTGG - Intronic
1130705374 15:86228287-86228309 ACCATCTGGCACTGATATCTGGG + Intronic
1134075628 16:11289379-11289401 CACATCTTGCACCCTGATCTTGG - Intronic
1134324549 16:13195123-13195145 CACACCTGGCACCTAGATTTTGG + Intronic
1134417450 16:14056637-14056659 CACACCTACCACTCAGATCTTGG - Intergenic
1135267219 16:21037773-21037795 GACATCTTGCGCTAAGAACTTGG + Exonic
1135661335 16:24299518-24299540 CACACCCAGCACTCAGATCTTGG - Intronic
1136087988 16:27899173-27899195 CACATCTGTGAATATGATCTGGG + Intronic
1136566621 16:31074299-31074321 CACTTCCGGCGCTAAGTTCTAGG - Intronic
1137923845 16:52520571-52520593 TACATCTGGCCCTAAGGTTTTGG - Intronic
1139031454 16:62886769-62886791 AACACCTAGCACTCAGATCTTGG - Intergenic
1140101351 16:71920241-71920263 CACATCTAGCACAGATATCTTGG + Intronic
1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG + Intronic
1142262525 16:89049626-89049648 CACAGCTGGCACTGGGCTCTCGG + Intergenic
1143245099 17:5477912-5477934 CACATCTAGCACCCAGATCTTGG + Intronic
1146055196 17:29577503-29577525 CACAGCTGGCACTGGGATTTGGG - Intronic
1147763372 17:42815893-42815915 CACATCTGGTAATGAGAGCTAGG - Exonic
1148002288 17:44396937-44396959 CACATTTGGCACTGTTATCTTGG - Intronic
1149619149 17:58029113-58029135 CACACCTAGCACCCAGATCTTGG + Intergenic
1153379114 18:4416055-4416077 CAATTCTGGCACTAGTATCTTGG + Intronic
1153429077 18:4995597-4995619 CACACCTGGCACCCAGACCTTGG - Intergenic
1154936388 18:21062128-21062150 CACACCTAGCACCCAGATCTTGG + Intronic
1155802671 18:30128620-30128642 CACACCTTGGACTCAGATCTTGG - Intergenic
1156580550 18:38370018-38370040 CACATTGGGCTGTAAGATCTCGG - Intergenic
1157137798 18:45074189-45074211 CATACCTGGCACTCAGAACTTGG - Intergenic
1157993271 18:52523103-52523125 CAGATCTGGGAATAAGATCTAGG - Intronic
1158516695 18:58136698-58136720 CAAGTCAGGCACTGAGATCTTGG + Intronic
1159069105 18:63603366-63603388 CAGATCTGGAACTCAGATTTTGG - Intronic
1159262240 18:66029454-66029476 CACACCTTGGACTGAGATCTTGG + Intergenic
1159893517 18:73974858-73974880 CACATCTGGTGCCCAGATCTTGG + Intergenic
1160934201 19:1585434-1585456 CACAACTGGCCCCTAGATCTGGG + Intronic
1161163328 19:2772605-2772627 CTCACCTGGAAATAAGATCTTGG + Intronic
1164624741 19:29718705-29718727 CAGATGTGGCCCTTAGATCTTGG - Intergenic
1164781273 19:30895596-30895618 CACATCTGACACTTGGATCTTGG - Intergenic
1165341770 19:35217633-35217655 CACTTCTGGCACCTTGATCTTGG - Intergenic
1165944460 19:39433414-39433436 CACATCTGGCAAGAAGAGCAGGG + Exonic
926264772 2:11305556-11305578 CTCATCTAGCACTCAGATCTTGG + Intronic
928051475 2:28001032-28001054 CACATCTGGCACTAAGATCTTGG - Intronic
928989998 2:37223014-37223036 TACAGCTGGTACTAAAATCTAGG + Intronic
930841120 2:55846473-55846495 CAAATATGACACTAAAATCTTGG + Intergenic
931054627 2:58455446-58455468 CATATCTGGGACTCAAATCTTGG - Intergenic
931500184 2:62856361-62856383 CACATCTGGCACTGGGAACGTGG - Intronic
932589047 2:73052238-73052260 CACATGTAGCACCCAGATCTTGG - Intronic
932601084 2:73126286-73126308 CACATCTAGCACTCAGATCATGG + Intronic
933533446 2:83539726-83539748 TCCTTCTGGCACTTAGATCTTGG + Intergenic
933996761 2:87675811-87675833 CACAGCTGGCACTCAGACCCAGG - Intergenic
934048182 2:88188904-88188926 TTCATCTGGTACTAAGATCCTGG - Intergenic
935862039 2:107342078-107342100 CACAGCTGGCACTCAAATATTGG + Intergenic
936653995 2:114463077-114463099 CACACCCAGCACCAAGATCTTGG - Intronic
937154354 2:119708076-119708098 CACATCTGACACTAATCTCAGGG + Intergenic
940732526 2:157409110-157409132 CACACATAGCACCAAGATCTTGG - Intergenic
941080590 2:161056345-161056367 CACATCTAGCACAGATATCTTGG - Intergenic
941411100 2:165158061-165158083 CACAGCTAGCACTCAGATCTTGG - Intronic
942571850 2:177323038-177323060 CTAAACTGGCACTTAGATCTGGG - Intronic
943431696 2:187810653-187810675 CACACCTGGCACCTAGATATTGG + Intergenic
943455155 2:188097567-188097589 GACATCTGGGTCTAAGCTCTGGG + Intergenic
944130678 2:196344708-196344730 TACATCTGGCATTAAGAGCCAGG - Intronic
946314488 2:218901032-218901054 CACATCTAGCACCCAGATCTTGG - Intergenic
948659494 2:239498371-239498393 CACATGTGGAACTATGATCTGGG - Intergenic
1169352086 20:4876349-4876371 CAGATTTGGGCCTAAGATCTGGG - Intronic
1170348224 20:15410893-15410915 AGCCTCTGGCAATAAGATCTTGG - Intronic
1171448275 20:25219654-25219676 CACATCAGACACTAAGGCCTTGG - Intronic
1173545571 20:43895165-43895187 CACGTCTGGCCCTAAAACCTGGG + Intergenic
1173644649 20:44625884-44625906 CACACCTCCCACTAAGATCTAGG - Intronic
1174397351 20:50255639-50255661 CACACCCGGCACCCAGATCTTGG - Intergenic
1174715083 20:52749008-52749030 CACATCTGGCACAAATCTGTTGG - Intergenic
1174728187 20:52887482-52887504 CACACCTAGCACCTAGATCTTGG + Intergenic
1175369483 20:58478291-58478313 CACACCTAGCACCCAGATCTTGG - Intronic
1175662477 20:60825937-60825959 CACATCTGGTACCCATATCTTGG - Intergenic
1176700349 21:10040452-10040474 CACATCTAGCATTCAAATCTTGG - Intergenic
1177592837 21:23194519-23194541 CACATCTGACACTCAATTCTAGG + Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1178762346 21:35415214-35415236 CACATCTGTCAGTCAGATTTTGG - Intronic
1179921446 21:44509731-44509753 CACAGCTGGCACTAACATTCAGG - Intronic
1180753954 22:18147321-18147343 TACATCTTGCACCCAGATCTTGG - Intergenic
1181625073 22:24117761-24117783 CACATCAGGCACTGAGAGCTTGG - Intronic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
949147158 3:715650-715672 CACCTCTAGCACCCAGATCTTGG - Intergenic
949981018 3:9501691-9501713 CACATCTGCCACAAAGCTCCAGG - Exonic
952314172 3:32218284-32218306 CACATCTTGCAATAATATCAGGG + Intergenic
952864739 3:37846732-37846754 CGCATCTGGCACCCAGATCTTGG + Intergenic
953252743 3:41261479-41261501 CACATCTGCCACTAAGTACCTGG + Intronic
953449691 3:42995882-42995904 CACATTTTGCTCTCAGATCTGGG - Intronic
955927267 3:64020016-64020038 TACACCTAGCACTAAGATCTTGG + Intronic
956226148 3:66961329-66961351 CACATCTAGCACCCAAATCTTGG - Intergenic
956660236 3:71590400-71590422 CACACCTAGCACCCAGATCTTGG + Intergenic
956721864 3:72125059-72125081 CACATATGGCCCTAAGCTTTTGG + Intergenic
960251061 3:115453917-115453939 TACATCTACCACCAAGATCTTGG - Intergenic
961073420 3:123959730-123959752 CACATCTAGTACCTAGATCTTGG - Intronic
961966149 3:130905147-130905169 CACACCTGGCACCCAGATCTTGG - Intronic
962418794 3:135208828-135208850 TACAGCTGGCTCTCAGATCTTGG + Intronic
966685593 3:182691354-182691376 CACACCTAGCACCCAGATCTTGG + Intergenic
966752274 3:183333812-183333834 CACATCTTGCATCCAGATCTTGG + Intronic
967327054 3:188251421-188251443 CACACCTAGCACTCAGATATTGG - Intronic
969541786 4:7796152-7796174 CACATCTGGCCCCCAGATCCTGG + Intronic
969931510 4:10635389-10635411 CACCTCTGACACTAATCTCTTGG + Intronic
970693166 4:18643187-18643209 TACATCCAGCACTAAGAACTTGG - Intergenic
974026718 4:56739258-56739280 CACATCTGGAATGAAGATCAGGG + Intergenic
974861201 4:67523739-67523761 CACACCTAGCACTCAGATCTTGG + Intronic
975561854 4:75716043-75716065 CACATCTAGGACTAGGGTCTAGG + Intronic
976877430 4:89871550-89871572 CACATCAGGGAGCAAGATCTTGG + Intergenic
977032895 4:91909397-91909419 TACATATGGGAATAAGATCTAGG - Intergenic
977044984 4:92058336-92058358 CCCTTCTGACACTAAGGTCTTGG - Intergenic
977369695 4:96120004-96120026 CACATCTGGAATTAAGACCCAGG + Intergenic
977664067 4:99624693-99624715 CACATTTGGAAATAAGATATTGG + Intergenic
978403560 4:108356189-108356211 CCCATCTGGCACTGTGAGCTGGG + Intergenic
978500850 4:109408627-109408649 CAAATCTGGGATTAAAATCTAGG + Intergenic
981219349 4:142213421-142213443 TGCCTCTGTCACTAAGATCTAGG + Intronic
982016506 4:151159661-151159683 CAAATCTAGCACATAGATCTTGG - Intronic
984042786 4:174757355-174757377 CACATCTGGTGATCAGATCTGGG + Intronic
984103867 4:175520050-175520072 AACATCTCGTACTAATATCTGGG - Intergenic
986422848 5:7601423-7601445 AATATCTGGCACTAAGATTTAGG + Intronic
986503220 5:8423401-8423423 CACATCTAGCACCCAGATCTTGG + Intergenic
988179374 5:27770086-27770108 CAAATCAGGCACAAAGATGTAGG - Intergenic
989110047 5:37898532-37898554 CACACCTAGCACTCAGATATTGG - Intergenic
989467509 5:41774369-41774391 CACACCTAGCACCCAGATCTTGG + Intronic
990003857 5:50923127-50923149 CACAGCTGGCAATAACAGCTTGG - Intergenic
990140704 5:52699805-52699827 CCCTTCTGGCACTTGGATCTTGG - Intergenic
994311523 5:98277957-98277979 CACAGCTGGCACCTTGATCTTGG - Intergenic
997533928 5:134601376-134601398 CACTGCTTGCACTAGGATCTTGG - Exonic
997816831 5:137027473-137027495 CACATCAGACACTATGATATAGG - Intronic
999168026 5:149567884-149567906 CACATTTGGTACCCAGATCTTGG - Intronic
999393132 5:151208784-151208806 CAGAGCTGGCACTAGAATCTAGG - Intronic
999788216 5:154911523-154911545 CATACCTAGCACTCAGATCTTGG - Intronic
1000135492 5:158345715-158345737 CACATCTGGCACTCAGTTTATGG + Intergenic
1000409398 5:160922221-160922243 CAGACCTGGCACTGAGGTCTGGG + Intergenic
1003139893 6:3462510-3462532 CACACCTAGCACCCAGATCTTGG + Intergenic
1003718715 6:8676174-8676196 CAGATGTGGGAATAAGATCTAGG - Intergenic
1004028670 6:11844653-11844675 CACATCTGTCACAAATTTCTAGG - Intergenic
1004799260 6:19128149-19128171 CACACCTAGCACCAAGATCTTGG + Intergenic
1005434103 6:25789080-25789102 CACATCTACCACTGAGATCTTGG + Intronic
1006658226 6:35615301-35615323 CAAACCTAGCACTCAGATCTTGG + Intronic
1007043365 6:38746475-38746497 CACATCTGGCAACCAGATTTTGG - Intronic
1007367511 6:41405405-41405427 AACATCTGTCCCTAAGCTCTTGG - Intergenic
1007391214 6:41550522-41550544 CACAGCTGGAACTAAAATATGGG + Intronic
1008213970 6:48761824-48761846 CAGATCTGCAATTAAGATCTTGG - Intergenic
1008590780 6:52991723-52991745 GACATCTAGCACCCAGATCTTGG + Intronic
1012809178 6:103936318-103936340 CACATCTTGCAATCAGATCATGG + Intergenic
1013204281 6:107932788-107932810 CACATCTAGCATGCAGATCTTGG + Intronic
1013268174 6:108520807-108520829 CAAATCTGGCACCCTGATCTTGG - Intronic
1015364398 6:132380864-132380886 CACATCTGGCACTGAAATCTGGG + Intronic
1016454671 6:144218000-144218022 CACACCTAGCACTGAGACCTTGG - Intergenic
1017505099 6:155061076-155061098 CACACCTGGCACCCAGAACTTGG - Intronic
1017556361 6:155575255-155575277 CACATCTGGCAGAAAGATGAGGG - Intergenic
1018017230 6:159723561-159723583 CACATCTGACACTGAGATCTTGG - Intronic
1018496391 6:164350182-164350204 CACTTCTAGCACTTAGATCATGG - Intergenic
1021847182 7:24774447-24774469 CACGTCTGGCTTTAAGATCCTGG + Intergenic
1022418604 7:30199284-30199306 CACATCTGACACTTACATCAGGG - Intergenic
1022421537 7:30228040-30228062 CACATATGGCATTAATTTCTGGG + Intergenic
1023445161 7:40223445-40223467 CACATCTAGTTCTCAGATCTTGG - Intronic
1023561711 7:41480781-41480803 CACACCTGGCACCCAGATTTTGG + Intergenic
1023957235 7:44896204-44896226 CACAACTGGGACCCAGATCTTGG + Intergenic
1028278869 7:88895547-88895569 CACATCCAGCACCAAGATCTTGG + Intronic
1028293131 7:89092887-89092909 TACATCTAGCACCCAGATCTTGG - Intronic
1029745983 7:102516155-102516177 CACCACTGGCACTAGGAACTAGG - Intronic
1029763921 7:102615134-102615156 CACCACTGGCACTAGGAACTAGG - Intronic
1031331633 7:120473046-120473068 CACAACTGGCCCTGAGAGCTTGG + Intronic
1031695430 7:124846058-124846080 CACACCTGGTGCTCAGATCTTGG - Intronic
1031956601 7:127948771-127948793 CAGATCTTGCACAAATATCTGGG - Intronic
1039590072 8:38738797-38738819 CACATCTAGCACCAAGATTTTGG - Intronic
1041474943 8:58253923-58253945 TACATCTGGCACCTATATCTTGG + Intergenic
1042633045 8:70842430-70842452 AACATCCGGCACCCAGATCTTGG - Intergenic
1044111276 8:88278353-88278375 CACATTTGGTTCTAAGACCTGGG + Intronic
1044708425 8:95031184-95031206 CACACCTAGCACCCAGATCTTGG - Intronic
1044721924 8:95159418-95159440 CACATCTGGTGCTCAGATCTTGG - Intergenic
1044754361 8:95446156-95446178 CACATCTGGCTCCAAGGTTTTGG + Intergenic
1045078864 8:98602951-98602973 CACACCTGGTACCAAGATCTTGG + Intronic
1045273927 8:100684731-100684753 CACACCTGGCACCCAGATATTGG + Intergenic
1045783339 8:105894207-105894229 CACATCTAGCACCCAGATTTCGG + Intergenic
1045841401 8:106586202-106586224 CACCTCTAGCACTACCATCTTGG - Intronic
1046406332 8:113777504-113777526 CACTTCTGCCACTTAGATGTAGG + Intergenic
1047329248 8:123871300-123871322 CACACCTGGCACTCAGATCTTGG + Intronic
1047467389 8:125130587-125130609 CACATCTGGAGCCCAGATCTTGG - Intronic
1047767109 8:127999010-127999032 CACATCTAGCACCCAGATCTTGG - Intergenic
1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG + Intergenic
1048030115 8:130623221-130623243 CACATCTAGCACCTAGATCTTGG - Intergenic
1048055497 8:130859083-130859105 CACATCTACCACTCACATCTTGG - Intronic
1048388157 8:133933021-133933043 CACACCTAACACTCAGATCTTGG - Intergenic
1048405957 8:134121230-134121252 CAGAACTAGCACTAAAATCTAGG - Intergenic
1049946503 9:601896-601918 CACGTCTGGTACTCAGATATTGG - Intronic
1050074900 9:1853208-1853230 GACATCTTGCACTCTGATCTTGG + Intergenic
1050225556 9:3450937-3450959 TACAACTGGCACCCAGATCTTGG + Intronic
1050297439 9:4219890-4219912 CACACCCAGCACTCAGATCTTGG + Intronic
1050299189 9:4239535-4239557 CACATCAGTCATTGAGATCTTGG + Intronic
1050394659 9:5182760-5182782 TTCACCTGGCACTAATATCTCGG + Intronic
1050526033 9:6547344-6547366 CAAGGCTGGCACTAAGAACTAGG + Intronic
1050840824 9:10146947-10146969 CATGTCTGGATCTAAGATCTTGG - Intronic
1051477796 9:17527693-17527715 CACACCTAGCACTCAGATTTTGG + Intergenic
1053177719 9:35940681-35940703 AACAGCTGGCACTTTGATCTTGG + Intergenic
1053637551 9:40027274-40027296 CACATCTAGCATTCAAATCTTGG - Intergenic
1053768530 9:41437965-41437987 CACATCTAGCATTCAAATCTTGG + Intergenic
1054318339 9:63623844-63623866 CACATCTAGCATTCAAATCTTGG - Intergenic
1054547198 9:66349446-66349468 CACATCTAGCATTCAAATCTTGG + Intergenic
1055099431 9:72447808-72447830 CACATCTAGTGCTCAGATCTTGG - Intergenic
1055223561 9:73967182-73967204 CCCATTTGGCACTATTATCTAGG + Intergenic
1057403840 9:94749436-94749458 CACAACTGGCACCTAGATCTTGG - Intronic
1061291012 9:129650210-129650232 CACATCTGGAACCAATATGTGGG + Intergenic
1062257592 9:135635641-135635663 CACACCTGGTACCCAGATCTTGG - Intronic
1062329851 9:136034531-136034553 CAAATCTAGCACCAAGATCCTGG + Intronic
1202785359 9_KI270719v1_random:10517-10539 CACATCTAGCATTCAAATCTTGG - Intergenic
1189314436 X:40044247-40044269 CACATCTAGCACTAAGTTCTTGG - Intergenic
1189869094 X:45363733-45363755 CTCATCTGGCAGGATGATCTGGG - Intergenic
1190076020 X:47317765-47317787 GACAACTGGAACCAAGATCTTGG - Intergenic
1190150176 X:47939577-47939599 CACATATAGCAGTCAGATCTTGG + Intronic
1190421859 X:50292943-50292965 CACATCTAGCATCAATATCTTGG - Intronic
1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG + Intergenic
1191621413 X:63219392-63219414 CACATCTAGCACAAAGATCTTGG - Intergenic
1192171657 X:68859326-68859348 CACATCTGACACTGGGGTCTAGG + Intergenic
1195726413 X:107921962-107921984 CATATCTAGCACTCAGGTCTTGG - Intronic
1195777052 X:108418671-108418693 CTCTTCTGACACTAAAATCTGGG - Intronic
1198008363 X:132523038-132523060 CACACCTAGCACTCAGATCTTGG + Intergenic
1199859285 X:151785672-151785694 CACACCTAACACTTAGATCTTGG - Intergenic