ID: 928054344

View in Genome Browser
Species Human (GRCh38)
Location 2:28036430-28036452
Sequence ATGTGTTGATTAGATCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928054340_928054344 10 Left 928054340 2:28036397-28036419 CCATTAACTTATTTACTTCAAAG 0: 1
1: 0
2: 2
3: 32
4: 377
Right 928054344 2:28036430-28036452 ATGTGTTGATTAGATCAGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928054344 Original CRISPR ATGTGTTGATTAGATCAGGG AGG Intronic
901255646 1:7823789-7823811 AAGTGTCAATTAGATCAAGGTGG - Intronic
905695520 1:39970661-39970683 ATGTGTGTATCAGATGAGGGAGG + Intergenic
907869441 1:58430065-58430087 AGGAGGTGATTAGATCAGGAAGG - Intronic
908565638 1:65353159-65353181 ATCTTTTGATTAGAGAAGGGAGG + Intronic
908786604 1:67740684-67740706 AGGTGGTGATTAGATCATGAGGG + Intronic
909083574 1:71145791-71145813 AGGAGGTGATTAGATCATGGGGG + Intergenic
909287725 1:73841570-73841592 ATGTGTTGGTTAGATCTAGTTGG - Intergenic
911834409 1:102597509-102597531 ATGTGTTGTTAAGACCAGGCAGG - Intergenic
914239585 1:145844553-145844575 TGGTGTTGGATAGATCAGGGTGG + Intergenic
915654689 1:157349611-157349633 GTGGGGTGATTAGATCATGGAGG - Intergenic
918837479 1:189486262-189486284 ATTTGTTGTTCAGTTCAGGGTGG - Intergenic
920699144 1:208204534-208204556 ATGTGTTGGGTAGGTCAGTGAGG - Intronic
923625825 1:235613033-235613055 AGGAGGTGATTAGATCATGGGGG - Intronic
924152601 1:241143810-241143832 AAGAGTTGATTAGATCATGAGGG + Intronic
1065486342 10:26239651-26239673 TTGTGGTGATGAGATTAGGGTGG + Intronic
1066132292 10:32406135-32406157 AGGAGTTGATTGGATCATGGGGG - Intergenic
1068141147 10:53009085-53009107 AGGAGTTGATTGGATCATGGTGG - Intergenic
1068200188 10:53774225-53774247 AGGTGGTGATTGGATCATGGAGG - Intergenic
1068812020 10:61266699-61266721 ATATGTTGAGTCCATCAGGGTGG + Intergenic
1069065313 10:63936413-63936435 AAGAGGTGATTAGATCAGGAGGG + Intergenic
1070945114 10:80384413-80384435 ATTTGTTGAAAAGATCAGGCCGG + Intergenic
1071773414 10:88756034-88756056 ATGAGGTGATTTGATCATGGGGG - Intergenic
1077699084 11:4423395-4423417 AGGAGGTGATTAGATCATGGGGG - Intergenic
1078261855 11:9716809-9716831 AAGAGTAGGTTAGATCAGGGAGG + Intronic
1078407587 11:11084146-11084168 AGGTGTCCATTAGATTAGGGTGG + Intergenic
1081367746 11:42257194-42257216 ATGTGGTGATTGGATCATAGAGG - Intergenic
1083035953 11:59637609-59637631 ATGTGTTGTTTCGATTAAGGTGG + Exonic
1084277774 11:68063698-68063720 AGGAGGTGATTAGATCATGGGGG + Intronic
1088459156 11:110064470-110064492 ATGTTTTAATTAGCTCAGTGTGG + Intergenic
1088709398 11:112493700-112493722 AAGAGTTGATTAGGTCATGGGGG - Intergenic
1095760772 12:45832992-45833014 ATATGTATATTAGATCATGGGGG + Intronic
1095868851 12:47003515-47003537 ATGTGTTGATTAAATGAATGTGG + Intergenic
1097301756 12:58026581-58026603 ATCTGTTGATTTGCTCTGGGAGG + Intergenic
1097907849 12:64938662-64938684 ATGTGCTGAATACATCATGGGGG + Intergenic
1101103328 12:101416858-101416880 ATGAGGTGATTAGATCATGAGGG + Intergenic
1101402765 12:104402756-104402778 AGGAGTTGATTAGGTCAGGAGGG - Intergenic
1101550682 12:105758692-105758714 ATGTATAGACTAGATCAGGAAGG - Intergenic
1104964975 12:132504821-132504843 TTGTGTGGATTAGATAAGCGGGG + Intronic
1107262179 13:38506177-38506199 GGGTGTTCATTAGATCATGGGGG + Intergenic
1107511144 13:41086151-41086173 ATGTGTGAATTAGACCAGGTGGG - Intergenic
1107722263 13:43261156-43261178 ATGTGTTGGTCAGATCCTGGTGG + Intronic
1108861380 13:54863627-54863649 AAGTGTTGATTACATCAAGTTGG - Intergenic
1109232989 13:59781829-59781851 ATGAGGTGATTAGGTCAGGAGGG + Intronic
1110241305 13:73270230-73270252 AGGAGGTGATTAGATCATGGGGG - Intergenic
1110692434 13:78446557-78446579 ATGTCTTGATTAGATAAGAAAGG + Intergenic
1110742016 13:79008615-79008637 AGGAGGTGATTAGATCATGGGGG - Intergenic
1111980200 13:95007498-95007520 AGGTGATGATTGGATCATGGGGG - Intergenic
1113321957 13:109242539-109242561 AGGTGGTGATTGGATCATGGGGG + Intergenic
1114927649 14:27423533-27423555 AGGAGGTGATTAGATCATGGGGG - Intergenic
1115255887 14:31401236-31401258 AGGAGGTGATTAGATCAAGGGGG + Intronic
1117428346 14:55624620-55624642 AGATGTATATTAGATCAGGGAGG + Intronic
1119854807 14:77891557-77891579 ATGTGATGCTTATCTCAGGGAGG - Intronic
1121424180 14:93836570-93836592 GTGAGGTGATTAGATCATGGGGG - Intergenic
1123064761 14:105611988-105612010 AGGAGGTGATTAGATCAAGGGGG + Intergenic
1123074061 14:105657628-105657650 AGGAGGTGATTAGATCAAGGGGG + Intergenic
1123088063 14:105727204-105727226 AGGAGGTGATTAGATCAAGGGGG + Intergenic
1123094019 14:105756577-105756599 AGGAGGTGATTAGATCAAGGGGG + Intergenic
1124194329 15:27607615-27607637 GTATGGTGATCAGATCAGGGTGG - Intergenic
1125490990 15:40148252-40148274 AAGTGGTGATTAGATCATGAGGG + Intergenic
1126265893 15:46753567-46753589 AGGTGTTGATTAGATAATGAAGG + Intergenic
1128506236 15:68274890-68274912 TAGTGTTGAATAGATCTGGGTGG - Intergenic
1130094129 15:80843748-80843770 ATGTGTTGAGGAGATCATGAAGG + Intronic
1134350245 16:13430761-13430783 TTGTTTTGATTAGCTGAGGGTGG + Intergenic
1136725259 16:32352455-32352477 ATGTGGTGATTGGCTCAGGCAGG - Intergenic
1138997465 16:62472761-62472783 ATGAGGTGATTGGATCATGGGGG + Intergenic
1140743110 16:77959133-77959155 ATGTGGGGAATAGATGAGGGTGG - Intronic
1142212545 16:88815325-88815347 ATGAGTTGAGAAGCTCAGGGTGG - Intronic
1203001171 16_KI270728v1_random:165299-165321 ATGTGGTGATTGGCTCAGGCAGG + Intergenic
1203132774 16_KI270728v1_random:1701703-1701725 ATGTGGTGATTGGCTCAGGCAGG + Intergenic
1142924745 17:3224635-3224657 ATGAGGTGATTGGATCACGGAGG + Intergenic
1144270418 17:13610103-13610125 CTGTGTTGATTCAATCAGAGAGG - Intergenic
1147165329 17:38590138-38590160 ATGTGTGGATTGGAGAAGGGAGG - Intronic
1152550665 17:81028363-81028385 ATGTGTTGCTCAGAGCAGGCAGG + Intergenic
1153275906 18:3367611-3367633 ATGAGTTGATTAGGTCATGAAGG - Intergenic
1153386546 18:4504193-4504215 AGGAGGTGATTAGATCATGGGGG - Intergenic
1153455716 18:5279805-5279827 AGGAGGTGATTAGATCATGGGGG - Intergenic
1153567424 18:6432330-6432352 GTGAGATGTTTAGATCAGGGTGG + Intergenic
1155420930 18:25655160-25655182 GGGTGATGATTAGATCATGGGGG - Intergenic
1158023992 18:52874158-52874180 ATGTTTTCAATAGATCAAGGAGG + Intronic
1158791534 18:60785404-60785426 AGGAGTTGATTGGATCATGGAGG + Intergenic
1163061959 19:14767543-14767565 CTGTGTGGATTAGAAAAGGGAGG - Intronic
1165784647 19:38453788-38453810 AGGTGGTGATTGGAGCAGGGAGG + Intronic
1166212125 19:41313519-41313541 ATGTGTTGTGTGTATCAGGGAGG - Intronic
1166565634 19:43763798-43763820 AAGTGTTGATTTGGTGAGGGGGG + Intergenic
1167106826 19:47435302-47435324 ATCAGGTGATTAGATCGGGGTGG - Intronic
1168552535 19:57309594-57309616 GGGTGGTGATTAGATCATGGGGG + Intergenic
926142474 2:10375969-10375991 GGGAGTTGATTGGATCAGGGGGG + Intronic
927389670 2:22581391-22581413 AGGAGGTGATTAGATCATGGGGG + Intergenic
927785803 2:25973935-25973957 ATGTGTTTAATATATCAGGAAGG + Intronic
928054344 2:28036430-28036452 ATGTGTTGATTAGATCAGGGAGG + Intronic
929274022 2:40006031-40006053 GTGAGGTGATTAGATCATGGGGG - Intergenic
930754845 2:54963796-54963818 ATGTCTTGATTAGAGCAGCTTGG - Intronic
932226598 2:70046140-70046162 ATGTGCTGACTAGAGCAGGAGGG - Intergenic
934320619 2:91968104-91968126 ATGTGGTGATTGGCTCAGGCAGG + Intergenic
936674683 2:114701367-114701389 ATCTGTTCATTAGATGAGGCAGG + Intronic
939405997 2:141756855-141756877 ATGTGTTGATTTCATCACTGTGG - Intronic
940288782 2:152057961-152057983 AGGAGGTGATTAGATCATGGAGG + Intronic
941889280 2:170561251-170561273 ATGGGTTAATTTGCTCAGGGTGG - Intronic
942747100 2:179246584-179246606 AAATGTTGATTAGATCTGGTTGG - Intronic
943943375 2:194027867-194027889 ATGAGTTGATGAGAGCTGGGTGG - Intergenic
944334347 2:198513276-198513298 AAGTGTTGATCAGGTTAGGGAGG - Intronic
944582923 2:201148405-201148427 ATGACTTGATTAGGTCAGGGAGG - Intronic
944957528 2:204829619-204829641 AGGAGGTGATTAGATCAGAGGGG + Intronic
945653053 2:212588908-212588930 ATGCGTTCCTTTGATCAGGGAGG - Intergenic
945745270 2:213713137-213713159 AGGAGGTGATTAGATCATGGGGG - Intronic
947023364 2:225709075-225709097 ATGTGTTGATCAGTTAAGGGAGG - Intergenic
948376764 2:237525877-237525899 GTGTGTTGGATAGGTCAGGGTGG - Intronic
1168997398 20:2143618-2143640 ATGTGTGAATAAGACCAGGGAGG + Intronic
1171061841 20:21971930-21971952 ATGTGTGGATTATCTCAGGCAGG + Intergenic
1175155431 20:56968046-56968068 ATGTGCTGATTGGACCAGGGTGG - Intergenic
1176987937 21:15459674-15459696 ATGTGTACATTTCATCAGGGTGG + Intergenic
1177592607 21:23190908-23190930 AGGAGGTGATTAGATCATGGGGG + Intergenic
1178740337 21:35194192-35194214 ATGAGGTGATTGGATCATGGGGG - Intronic
1180308869 22:11152163-11152185 ATGTGGTGATTGGCTCAGGCAGG + Intergenic
1180547346 22:16513974-16513996 ATGTGGTGATTGGCTCAGGCAGG + Intergenic
1182402218 22:30087317-30087339 ATGTGTTGAGAACATCAAGGTGG + Intronic
1183958600 22:41397398-41397420 GTGTGTTTATTTGCTCAGGGCGG + Exonic
949898481 3:8790521-8790543 ATGTGTGAATTAGCTGAGGGTGG + Intronic
951756318 3:26095563-26095585 ATCTGATGATTAAATAAGGGGGG - Intergenic
953428222 3:42813602-42813624 AGGAGGTGATTAGATCACGGGGG - Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
955403595 3:58610956-58610978 AGGAGTTGATTGGATCATGGGGG + Intronic
955636547 3:61036317-61036339 AGGGGGTGATTAGATCAGGGGGG - Intronic
956909583 3:73803677-73803699 GGGAGTTGATTAGATCATGGGGG + Intergenic
957132328 3:76238678-76238700 GGGAGTTGATTAGATCATGGAGG - Intronic
957132345 3:76238757-76238779 GGGAGTTGATTAGATCATGGAGG - Intronic
957549770 3:81689150-81689172 ATGTGTTTATTAGATCTGTAGGG + Intronic
958530824 3:95328750-95328772 CTGTGTTGAATAGTTCAGGGAGG + Intergenic
959124281 3:102271393-102271415 AGGAGGTGATTAGATCATGGGGG - Intronic
959470393 3:106742824-106742846 AGGAGGTGATTAGATCAGGAGGG - Intergenic
961186902 3:124923154-124923176 ATGTTTTGATTAGATCACCAGGG - Intronic
964351706 3:155809696-155809718 AGGTGATGAATAGATCATGGTGG - Intergenic
965681938 3:171260508-171260530 ATGTGTTGATTTGGCCGGGGTGG + Intronic
966755038 3:183361408-183361430 AGGAGGTGATTAGATCATGGGGG + Intronic
967203639 3:187099135-187099157 ATTTGTTGATCAGATCTAGGAGG - Intergenic
968244950 3:197135311-197135333 AGGAGGTGATTAGATCACGGAGG + Intronic
969170199 4:5356104-5356126 ATGTGAGAAATAGATCAGGGAGG + Intronic
969245220 4:5927518-5927540 AGGAGGTGATTAGATCATGGGGG + Intronic
970057075 4:11987006-11987028 ATGTATTGATTAGATGTGGGTGG - Intergenic
970344274 4:15137964-15137986 ATGGGGTGATTAGATCATGGGGG + Intergenic
970543268 4:17100763-17100785 AAGAGTTTATTAGATCTGGGTGG + Intergenic
971638605 4:29098648-29098670 ATGTTTTGATTAAATGAGTGAGG - Intergenic
971968192 4:33590538-33590560 ATGTGCAGATGTGATCAGGGAGG + Intergenic
972888052 4:43517530-43517552 GGGTGGTGATTAGATCATGGGGG - Intergenic
972930007 4:44060857-44060879 TGGTGGTGATTAGATCATGGGGG - Intergenic
974424521 4:61723688-61723710 ATGTGGTGACTAGAAGAGGGAGG + Intronic
975072843 4:70163653-70163675 ATGTGTGTATGTGATCAGGGTGG - Exonic
976045497 4:80941919-80941941 AGGAGGTGATTAGATCATGGAGG - Intronic
978406110 4:108380540-108380562 ACGAGATGATTAGATCAGGAGGG - Intergenic
978596346 4:110381088-110381110 TTGTGTAGTTGAGATCAGGGGGG - Intronic
978777295 4:112516431-112516453 TTATGTTGATTAGATAAAGGGGG - Intergenic
980263900 4:130491249-130491271 GTGAGGTGATTAGATCATGGGGG + Intergenic
980747053 4:137032029-137032051 ATGTATTGGTTAGAGCTGGGGGG - Intergenic
983271379 4:165566301-165566323 ATGTGTTGATGAGAGCATAGAGG + Intergenic
984058786 4:174965373-174965395 ATGTGATGTTCAGATCATGGGGG - Intronic
984321293 4:178199487-178199509 ATGTGATGATAAGATATGGGGGG - Intergenic
984944271 4:184959028-184959050 CTGTGTAGCTTACATCAGGGCGG - Intergenic
985894858 5:2743023-2743045 ATGTGTTTATTAGATCTCTGCGG - Intergenic
987086041 5:14468781-14468803 ATGTGTTTATTGGGTTAGGGAGG + Intronic
987617906 5:20300667-20300689 TTCTATTTATTAGATCAGGGAGG - Intronic
989812149 5:45691788-45691810 ATGTGTTCATTAGGGAAGGGAGG - Intronic
990856749 5:60276127-60276149 AAGTGTTGATTAGATCCAGTTGG + Intronic
993107638 5:83617538-83617560 AGGTGGTCATTAGATCATGGGGG + Intergenic
994165996 5:96608922-96608944 AGGTGATTATTAGATCATGGGGG - Intronic
994296490 5:98095219-98095241 AGGAGGTGATTAGATCATGGGGG + Intergenic
995780233 5:115767535-115767557 GTGAGGTGATTAGATCATGGGGG + Intergenic
996922876 5:128789670-128789692 AAGTGTTGATTAGATCCTGTTGG + Intronic
997855599 5:137369853-137369875 AGGTTTTGATTAGGTCATGGGGG - Intronic
998395070 5:141812937-141812959 ATGTGTTGAGATTATCAGGGAGG - Intergenic
999356364 5:150936274-150936296 AGATGTTGATTAGATCAGATTGG - Intergenic
1001944623 5:175768471-175768493 AGGAGGTGATTAGATCATGGGGG - Intergenic
1003740233 6:8928647-8928669 ATTTGTTTATTATATCAGTGAGG + Intergenic
1005167230 6:22938596-22938618 AGGAGGTGATTAGATCATGGGGG - Intergenic
1008711002 6:54227025-54227047 GTGAGGTGATTAGATCATGGGGG + Intronic
1009328995 6:62391708-62391730 ATGTGTTGATTTCATTATGGAGG - Intergenic
1010471542 6:76234038-76234060 ATGAGGTGATTAGGTCAGGAGGG + Intergenic
1012125408 6:95421952-95421974 AGGAGGTGATTAGATCATGGGGG - Intergenic
1012810700 6:103953699-103953721 AGTTGTTTATTAGATCAAGGAGG - Intergenic
1013745639 6:113342739-113342761 ATGTGTTGATGAGTTCAGTCTGG - Intergenic
1014806326 6:125833637-125833659 ATGTCTTGTTTCAATCAGGGTGG + Intronic
1015084749 6:129276712-129276734 ATATGTTCATTTGATAAGGGTGG - Intronic
1017299175 6:152835710-152835732 TTGTAATGATTAAATCAGGGTGG + Intergenic
1024113051 7:46165965-46165987 AGGAGGTGATTAGATCATGGGGG - Intergenic
1024171958 7:46798048-46798070 AGGAGGTGATTAGATCATGGGGG - Intergenic
1024754858 7:52518002-52518024 ATGGGGTGATTGGATCATGGGGG - Intergenic
1026348406 7:69494735-69494757 AATTCTTGATTAGATCAGTGTGG - Intergenic
1030141604 7:106310047-106310069 AGGAGGTGATTAGATCATGGGGG - Intergenic
1031618127 7:123904937-123904959 GGGAGTTGATTAGATCATGGGGG - Intergenic
1031774480 7:125890308-125890330 AGGTGGTGATTGGATCATGGAGG + Intergenic
1031981473 7:128129308-128129330 ATCTGATGATTGGATCATGGGGG + Intergenic
1035884983 8:3281841-3281863 AGGGGTTGATTGGATCATGGGGG + Intronic
1036585959 8:10123956-10123978 AAGTCTCGATGAGATCAGGGAGG + Intronic
1036996987 8:13669083-13669105 AGGTGATGATTGGATCATGGGGG + Intergenic
1038016367 8:23519193-23519215 GTGTGTTTATTACATCAAGGAGG + Intergenic
1039650296 8:39334183-39334205 CTGTGTTGATGAAATCAGGCCGG + Intergenic
1040632568 8:49232714-49232736 ATGTGAAGATTAGATCAGAGTGG - Intergenic
1044359077 8:91260334-91260356 AGGAGGTGATTAGATCACGGTGG - Intronic
1046257517 8:111721011-111721033 ATGAGGTGATTGGATCATGGAGG - Intergenic
1046647735 8:116804309-116804331 AGGAGGTGATTAGATCATGGGGG + Intronic
1048504398 8:135007628-135007650 ATGTGTTAATTTGATGAAGGTGG + Intergenic
1051575409 9:18609716-18609738 GTGTGTTGATTATTTTAGGGGGG - Intronic
1051767597 9:20541614-20541636 GGGTGTTGATTGGATCATGGGGG - Intronic
1052012066 9:23422162-23422184 AGGAGGTGATTAGATCATGGGGG + Intergenic
1058226455 9:102370623-102370645 AAGTGTTGATTAGATCCTGTTGG - Intergenic
1060101789 9:120847132-120847154 ATGTGCTGGTTTGAGCAGGGAGG + Intergenic
1060726318 9:126008216-126008238 AGGAGGTGATTAGATCATGGGGG + Intergenic
1186706087 X:12140011-12140033 ATGTGTTGATTGCATCAGGCAGG + Intronic
1187682897 X:21785911-21785933 ATGAGTTGATTAAATCAGGGAGG + Intergenic
1192092738 X:68177807-68177829 AGGAGATGATTAGATCATGGGGG - Intronic
1193689696 X:84625805-84625827 ATGTATTTATCAGATCTGGGAGG + Intergenic
1194372900 X:93096336-93096358 GTGAGGTGATTAGATCATGGGGG - Intergenic
1197234534 X:124044870-124044892 ATGTTTTGTTTTGATGAGGGAGG + Intronic
1199250637 X:145658307-145658329 AGGAGGTGATTAGATCATGGGGG + Intergenic
1199895454 X:152122449-152122471 ATGTGTTTTTTATATCGGGGTGG + Intergenic
1200680939 Y:6210377-6210399 GTGAGGTGATTAGATCATGGGGG - Intergenic
1201188119 Y:11423209-11423231 ATGTGGTGATTGGCTCAGGCAGG + Intergenic
1201640952 Y:16176415-16176437 ATGTGGTGATGAGATCATGAGGG - Intergenic
1201661864 Y:16408911-16408933 ATGTGGTGATGAGATCATGAGGG + Intergenic