ID: 928056537

View in Genome Browser
Species Human (GRCh38)
Location 2:28061966-28061988
Sequence CCAGGATTGTTGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928056532_928056537 21 Left 928056532 2:28061922-28061944 CCTGTTGTATTTGGTAGTAGATT 0: 1
1: 0
2: 1
3: 9
4: 127
Right 928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG 0: 1
1: 0
2: 4
3: 63
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928056537 Original CRISPR CCAGGATTGTTGGCCAGGTG CGG Intronic
900158851 1:1213977-1213999 CCACGAGTGCAGGCCAGGTGAGG - Exonic
900211332 1:1457302-1457324 ACAGCATTTTTGGCCAGGTGTGG + Intronic
900217686 1:1490437-1490459 CCTGGATTGGGGGCCGGGTGAGG - Intronic
901135936 1:6995590-6995612 CAAAGATTTTAGGCCAGGTGCGG - Intronic
901404643 1:9038130-9038152 CCAGGACTCTTGGGCATGTGGGG + Intronic
901532149 1:9860298-9860320 CCAGGATTCTAGGCCGGGTGTGG + Intronic
901943170 1:12679444-12679466 CCATCAATGTTGGCCAGGTATGG + Intergenic
902040996 1:13492408-13492430 AAAGGATTTTTGGCCGGGTGCGG + Intronic
902324989 1:15694061-15694083 ACAGGTTTCTTGGCCAGGTGTGG + Intronic
903547008 1:24130993-24131015 AAATCATTGTTGGCCAGGTGAGG - Intronic
903976261 1:27152348-27152370 CCAGGTGTGGTGGGCAGGTGAGG + Intronic
904707360 1:32401375-32401397 TCAGGAATTTTGGCCGGGTGTGG + Intergenic
905612230 1:39363900-39363922 TGAGTCTTGTTGGCCAGGTGTGG - Intronic
906298464 1:44663528-44663550 CAATGACTTTTGGCCAGGTGCGG - Intronic
906796498 1:48700341-48700363 CCAGGATGGTTAGCAAGGAGAGG + Intronic
907076341 1:51582618-51582640 AAAAGACTGTTGGCCAGGTGTGG - Intronic
907271987 1:53296603-53296625 CCAGGTTAGTAGGCCAGGGGCGG - Intronic
907358182 1:53893445-53893467 CCATGATTGGGGGCCGGGTGCGG + Intronic
907540132 1:55208335-55208357 ACAATAATGTTGGCCAGGTGCGG + Intronic
908282587 1:62557188-62557210 TGAGGACTTTTGGCCAGGTGTGG - Intronic
909467354 1:75987260-75987282 CTATGATTTTTGGCCAGGCGCGG - Intergenic
909852489 1:80486087-80486109 CCAGGATTGGTGACCAGCTTGGG - Intergenic
909931936 1:81506416-81506438 CAAGAAATGTTGGCCAGGCGCGG + Intronic
910678295 1:89837169-89837191 CCAGGATTCTGGTCAAGGTGAGG + Intronic
910679620 1:89848986-89849008 ACAGGGTTATTGGCCAGGTACGG - Intronic
910789364 1:91035394-91035416 TCACTATTTTTGGCCAGGTGTGG - Intergenic
911203647 1:95071255-95071277 GCAGGATTTTAGGCCAGGGGTGG + Intronic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
915046704 1:153023407-153023429 CCAGGAGGGGTGGGCAGGTGTGG + Intergenic
915201584 1:154233611-154233633 TCAGGCTGGGTGGCCAGGTGCGG - Intronic
915677197 1:157542810-157542832 GCAGGACTCTTGGCCAGGGGTGG + Intronic
915724583 1:158008347-158008369 CCAGCACTGTGGACCAGGTGAGG - Intronic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
917964773 1:180171492-180171514 CCAGGAGTCTAGGACAGGTGAGG + Intronic
918570303 1:185982729-185982751 TTAGGAATGTGGGCCAGGTGTGG - Intronic
919635302 1:199997991-199998013 TAAGGATTGATGGTCAGGTGAGG + Intergenic
920642190 1:207763273-207763295 CCCGGAGTGCTGGCCAGGCGTGG + Intronic
920789676 1:209077832-209077854 GCAGCATTATTGGCCAGGCGCGG - Intergenic
921224306 1:213002625-213002647 TAAAAATTGTTGGCCAGGTGCGG + Intronic
922150042 1:222993154-222993176 TCTGGATTCTTGGCCAGGTGCGG - Intronic
922521815 1:226259248-226259270 TAAGTATTGTTGGCCGGGTGTGG - Intronic
923039729 1:230310939-230310961 CCAGGATTGTTGTCCTGGCATGG - Intergenic
923090915 1:230740658-230740680 TTAGGATTTTTGGCCAGATGCGG + Intergenic
923441652 1:234026590-234026612 GAAGGCTTGTTAGCCAGGTGTGG + Intronic
924059327 1:240155178-240155200 CAAAGATTAGTGGCCAGGTGTGG - Intronic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924352620 1:243132407-243132429 CCAGTGTAGTTGGCAAGGTGAGG - Intronic
1063535802 10:6882370-6882392 TCATGAGTTTTGGCCAGGTGCGG + Intergenic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1065016385 10:21466561-21466583 TAAGAATTGTTGGCCAGGCGCGG + Intergenic
1065066592 10:21973810-21973832 ATATGATTTTTGGCCAGGTGCGG + Intronic
1065801446 10:29356627-29356649 CCAGGATTGGTGGCTCCGTGGGG - Intergenic
1066396639 10:35030671-35030693 AAAGTAGTGTTGGCCAGGTGTGG - Intronic
1066425746 10:35306323-35306345 CCAAGATGGTTGGCCAGGTATGG - Intronic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067158697 10:43804122-43804144 CCAGGAGTGTGGGGGAGGTGGGG - Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1070209262 10:74298613-74298635 TGAGGATTTTAGGCCAGGTGTGG + Intronic
1071202947 10:83240856-83240878 CGGGGTTTGTTGGCCGGGTGCGG - Intergenic
1071367454 10:84913518-84913540 CCAGGAGTGGTGGCCAAGTATGG + Intergenic
1073225278 10:101913269-101913291 CAAGAATTCCTGGCCAGGTGTGG - Intronic
1073298860 10:102458447-102458469 ACAAGATTGCTGGCCAGGTGCGG - Intergenic
1073357302 10:102867289-102867311 TAAGGATTGTTGGCCAGGTGTGG + Intronic
1074002165 10:109384138-109384160 AAAGGATTGTGGACCAGGTGTGG - Intergenic
1074088871 10:110228016-110228038 ACAGGATTGATGTCCAGGCGAGG + Intronic
1074773995 10:116753078-116753100 CAAGGGATGTTGGCCACGTGTGG + Intergenic
1075803804 10:125170727-125170749 ACAGAAATATTGGCCAGGTGTGG + Intergenic
1076020566 10:127069311-127069333 ACAGGATTGTTGGCCAAGTTAGG + Intronic
1076898119 10:133324401-133324423 CCAGGCTTGCTGGCTAGGTGCGG - Intronic
1077527115 11:3073698-3073720 GAAGGATCGTTGGCCAGGCGTGG - Intergenic
1078540729 11:12211087-12211109 CCAAGGTTGTTGGCCAGGCGTGG + Intronic
1079165735 11:18041119-18041141 CTAAGATTGTGGGCAAGGTGGGG - Exonic
1082008212 11:47432740-47432762 CCAGTATCGTTGGCCAGGTGCGG + Intergenic
1083060970 11:59871424-59871446 ACAAGATTCTTGGCCAGGCGTGG - Intergenic
1083223864 11:61271433-61271455 TGTGTATTGTTGGCCAGGTGCGG - Intronic
1083481351 11:62949654-62949676 CCAGGACTCCTGGCCAGGTGTGG - Intronic
1083735690 11:64679345-64679367 TCAGGATTGAGGGCCAGGCGTGG + Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084265940 11:68005133-68005155 CAAGGATTGCTGGGAAGGTGGGG + Intergenic
1084417649 11:69042744-69042766 CCAGGGATGCTGGCCAGGTGTGG - Intergenic
1084836926 11:71809057-71809079 CCAGGACTGATGGGCTGGTGGGG - Intergenic
1085765552 11:79278853-79278875 ACAGGATTGTTTTCAAGGTGAGG + Intronic
1085803632 11:79614315-79614337 GCAGGACTGTTAGCCAGGAGGGG + Intergenic
1086102175 11:83112492-83112514 ACAGCATTGGTGGCCAGGTGTGG + Intergenic
1087264723 11:96047618-96047640 CTAGGCTTGTTGGCCGGGCGCGG + Intronic
1087391115 11:97536675-97536697 AAAGAATTTTTGGCCAGGTGTGG - Intergenic
1087408726 11:97763553-97763575 CTGGGATTGTAGGCCGGGTGCGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1088934926 11:114390119-114390141 CAAAGATTGTAGGCCAGGTGTGG - Intergenic
1089384250 11:118057619-118057641 GCAGTGTTGCTGGCCAGGTGTGG + Intergenic
1089448861 11:118576892-118576914 CCTGGAATTCTGGCCAGGTGTGG + Intronic
1089504977 11:118956823-118956845 CCAGATCTGTTGGCCAGGAGGGG + Intronic
1089506254 11:118964401-118964423 TTATTATTGTTGGCCAGGTGTGG + Intergenic
1089787268 11:120916953-120916975 CCAGGCTTTCCGGCCAGGTGTGG + Intronic
1089961438 11:122620594-122620616 GCATGAATTTTGGCCAGGTGTGG + Intergenic
1089992573 11:122875481-122875503 ACAGTAATATTGGCCAGGTGCGG + Intergenic
1090820808 11:130339688-130339710 CCTGCTTTGTTAGCCAGGTGTGG - Intergenic
1092402305 12:8187047-8187069 CCAGGACTGATGGGCTGGTGGGG + Intronic
1092832789 12:12461460-12461482 ATAGGAATGCTGGCCAGGTGCGG - Intronic
1092879529 12:12877276-12877298 CCAGCATTGTAAGCCAGGTGAGG - Intergenic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1095474088 12:42567535-42567557 TAAGCATTATTGGCCAGGTGCGG + Intronic
1096041419 12:48520547-48520569 ACAGGGTGGCTGGCCAGGTGGGG + Intronic
1097664571 12:62465017-62465039 GCATCATTTTTGGCCAGGTGTGG + Intergenic
1099080854 12:78178449-78178471 ACAGTATTTTGGGCCAGGTGGGG - Intronic
1102169776 12:110833532-110833554 ACAAGAATGTTGGCCAGGCGCGG + Intergenic
1102579789 12:113879098-113879120 GCAGGATGGGTGGCCAGGAGGGG - Intronic
1103577036 12:121885670-121885692 TCAGGAAATTTGGCCAGGTGCGG + Intergenic
1104143429 12:126009757-126009779 ACAGGAAGGATGGCCAGGTGTGG + Intergenic
1104472887 12:129044839-129044861 CAAGAATTATTGGTCAGGTGCGG + Intergenic
1104525778 12:129519897-129519919 CAAGCATTCTTGGCCAGGTGCGG - Intronic
1105369913 13:19793342-19793364 ACAGGAAAGTTAGCCAGGTGTGG - Intergenic
1105866613 13:24466469-24466491 TTTTGATTGTTGGCCAGGTGTGG - Intronic
1107346859 13:39471216-39471238 GCAGGAATGTTGGCCAGAGGAGG + Intronic
1107551961 13:41485103-41485125 CACTGATTGTTGGCCAGGTGTGG - Intergenic
1108323141 13:49305766-49305788 CCAGGATTTCAGTCCAGGTGTGG + Intergenic
1108406700 13:50110760-50110782 AAAATATTGTTGGCCAGGTGCGG + Intronic
1108429783 13:50341998-50342020 GGAGGATTGGTGGCTAGGTGAGG - Intronic
1108518572 13:51224176-51224198 AAAGAATTCTTGGCCAGGTGCGG + Intronic
1108638757 13:52362075-52362097 TAAGAATTGTTGGCCAGGCGCGG - Intergenic
1109071288 13:57772543-57772565 CCAATAATGGTGGCCAGGTGTGG + Intergenic
1109994186 13:70101717-70101739 ATAGGGCTGTTGGCCAGGTGTGG - Intronic
1110002879 13:70228197-70228219 ATATGATTTTTGGCCAGGTGTGG - Intergenic
1112331671 13:98481778-98481800 CTGGGATTATAGGCCAGGTGCGG - Intronic
1113727120 13:112613133-112613155 CCAAGATACGTGGCCAGGTGTGG - Intergenic
1113866134 13:113526427-113526449 TCAGCACAGTTGGCCAGGTGTGG + Intronic
1113875544 13:113592445-113592467 ACAGGATTCATGGCCAGGCGCGG - Intronic
1113887646 13:113669361-113669383 GCAGGATTGCTGGGCAGGCGGGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114330133 14:21628363-21628385 AGAGGACTCTTGGCCAGGTGCGG + Intergenic
1114757821 14:25280317-25280339 AGAGGAGTGTTGGCGAGGTGGGG - Intergenic
1115014111 14:28588891-28588913 AAAGTTTTGTTGGCCAGGTGTGG - Intergenic
1115844372 14:37510368-37510390 CCAAAAATATTGGCCAGGTGTGG - Intronic
1115996625 14:39202018-39202040 ACATGTTTTTTGGCCAGGTGTGG - Intergenic
1116834749 14:49759226-49759248 TTAAAATTGTTGGCCAGGTGCGG + Intergenic
1117412001 14:55458522-55458544 CCTGGATGGTTGGCCTGGGGAGG - Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118394765 14:65326734-65326756 AAATGATTTTTGGCCAGGTGTGG + Intergenic
1119971905 14:78980178-78980200 CCAGGAGTGGGGACCAGGTGAGG - Intronic
1120914076 14:89694976-89694998 AAATGATTGTTGGCCAGGTATGG - Intergenic
1121083916 14:91130594-91130616 AAAAGATTCTTGGCCAGGTGTGG - Intronic
1121186288 14:91973312-91973334 CTAGTATTTTAGGCCAGGTGTGG - Intronic
1121717503 14:96086824-96086846 CCAGGAGTTTTGACCAGGGGCGG + Exonic
1121795040 14:96727750-96727772 GCAGCATGGTTGGCCAGGCGTGG + Intergenic
1121904362 14:97726271-97726293 GCAGGGTTGCAGGCCAGGTGGGG - Intergenic
1121994537 14:98592117-98592139 ATAGCATTGCTGGCCAGGTGTGG - Intergenic
1122262763 14:100532524-100532546 CCAGGCTCCTTGGGCAGGTGTGG + Intergenic
1122551722 14:102553839-102553861 AAAGGAATGCTGGCCAGGTGTGG + Intergenic
1122688273 14:103520227-103520249 CCAGGTTGGATGGGCAGGTGAGG + Exonic
1123430967 15:20215999-20216021 CCAGGAGTCTTGGGCAGGCGAGG + Intergenic
1123717743 15:23042974-23042996 CCAGGACCTCTGGCCAGGTGGGG - Intergenic
1124130947 15:26985193-26985215 CCAGCATTCCTGCCCAGGTGGGG - Intronic
1125108086 15:35997422-35997444 TTAAGAATGTTGGCCAGGTGCGG - Intergenic
1125731065 15:41893100-41893122 CCAGGATGGGAGGACAGGTGAGG - Intronic
1127063140 15:55207944-55207966 TCAGGTTTTTTGGCCAGGTGTGG - Intronic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127426354 15:58862766-58862788 ATAGGATTTCTGGCCAGGTGCGG + Intergenic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1127919534 15:63482319-63482341 GTAGGATAGTTGGCCAGGTGCGG - Intergenic
1128090972 15:64918661-64918683 CCCTCCTTGTTGGCCAGGTGCGG + Intronic
1132818054 16:1844412-1844434 ACAGAATGCTTGGCCAGGTGTGG - Intronic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1134024882 16:10946029-10946051 CCAGGATTTGGGGGCAGGTGTGG + Intronic
1134649230 16:15895453-15895475 CCAGGAAAATTAGCCAGGTGTGG + Intergenic
1134878040 16:17719738-17719760 CCACTATTGGTGGCCAGGAGGGG - Intergenic
1135346725 16:21695107-21695129 CCAACCTTGCTGGCCAGGTGTGG + Intronic
1135684997 16:24491740-24491762 CTGGGGTTCTTGGCCAGGTGAGG - Intergenic
1136656464 16:31712207-31712229 GCTGGATTGAAGGCCAGGTGGGG + Intergenic
1136853687 16:33635248-33635270 CCAGGAGTCTTGGGCAGGCGAGG - Intergenic
1138326742 16:56178498-56178520 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
1138511117 16:57508877-57508899 TCAGGAGCGTGGGCCAGGTGCGG + Intergenic
1139015355 16:62683731-62683753 TCATCATTGTTGGCCAGGTACGG - Intergenic
1139513564 16:67440716-67440738 CCAGCATTGCTGGCCAGGGCAGG - Intronic
1139878399 16:70164567-70164589 TAAGGATTTTAGGCCAGGTGCGG + Intergenic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140359165 16:74330249-74330271 TAAGGATTTTAGGCCAGGTGCGG - Intergenic
1140639609 16:76956979-76957001 CCAAGATTGTTGGTAATGTGAGG + Intergenic
1141416793 16:83881656-83881678 ACATCATTCTTGGCCAGGTGTGG - Intergenic
1141776128 16:86123621-86123643 TTTGGATTTTTGGCCAGGTGCGG - Intergenic
1141898951 16:86977549-86977571 CCAGGATTGTGGGGGAGGTCAGG + Intergenic
1203115278 16_KI270728v1_random:1483693-1483715 CCAGGAGTCTTGGGCAGGCGAGG - Intergenic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1146028581 17:29344878-29344900 GGGGGATTGATGGCCAGGTGTGG + Intergenic
1146509855 17:33437509-33437531 CCAGGTTTAAGGGCCAGGTGTGG + Intronic
1147036028 17:37681684-37681706 TTAGTGTTGTTGGCCAGGTGTGG - Intergenic
1147304927 17:39556654-39556676 GCAGGATTGTTGGCAGGGAGGGG - Intronic
1149456295 17:56791262-56791284 CCAAGGTTGTGGGGCAGGTGAGG + Intergenic
1149720248 17:58836729-58836751 CCAGGATTATTGGCCGGGCGCGG + Intronic
1149968611 17:61193465-61193487 ACTGAATTTTTGGCCAGGTGCGG + Intronic
1150910975 17:69387169-69387191 ACAGGATTTCTGGCCAGGTGCGG + Intergenic
1152872384 17:82763447-82763469 ACAGGGTTTTGGGCCAGGTGCGG + Intronic
1153194217 18:2575632-2575654 CCAGGCTTGTAGACCGGGTGTGG + Intronic
1153373796 18:4353044-4353066 CCAGGGTTGTTGCCCAAATGCGG - Intronic
1153404571 18:4722220-4722242 CCAGGAGTGATGGAAAGGTGAGG + Intergenic
1153576303 18:6525085-6525107 AAATGATTGTTGGCCAGGTGTGG + Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1155678638 18:28461999-28462021 CTTTGATTGTGGGCCAGGTGTGG - Intergenic
1157093299 18:44661662-44661684 AAAGCATTTTTGGCCAGGTGTGG - Intergenic
1157961023 18:52153422-52153444 CCTTCATTGTAGGCCAGGTGCGG - Intergenic
1158096251 18:53775083-53775105 CAAAGATTTTTGGCCAGGCGTGG + Intergenic
1160737620 19:671202-671224 CCAGGGCCGTTGGCCAGGCGTGG + Intergenic
1161021768 19:2014446-2014468 CCAGGGATGCAGGCCAGGTGGGG + Intronic
1161065098 19:2233581-2233603 CCAGGTGTGATGGCCGGGTGTGG + Exonic
1161292963 19:3505708-3505730 ACAGGTTTTTAGGCCAGGTGCGG - Intergenic
1161807095 19:6450787-6450809 CAAAAATTATTGGCCAGGTGTGG + Intronic
1162115333 19:8425935-8425957 CGAGGATTGGGGGCCGGGTGCGG + Intronic
1162250666 19:9440572-9440594 TCAGTATTCTTGGTCAGGTGTGG + Intergenic
1162484214 19:10948891-10948913 CATGGATTCTGGGCCAGGTGTGG - Intergenic
1163704742 19:18805647-18805669 TCTGGGTTGTAGGCCAGGTGTGG - Intergenic
1165241759 19:34474409-34474431 CCAAAAATGTGGGCCAGGTGAGG + Intergenic
1165842410 19:38796989-38797011 CCATATTTTTTGGCCAGGTGTGG - Intergenic
1166352582 19:42207071-42207093 CCAGGCTGGCTGGGCAGGTGAGG - Intronic
1166538596 19:43591555-43591577 TCAGGATTCCTGGCCAGGGGCGG + Exonic
1166750652 19:45162634-45162656 CCCGGAGTGTAGGCCAGGTCGGG - Intronic
1167629013 19:50612061-50612083 AAAAGATAGTTGGCCAGGTGTGG - Intergenic
1167634638 19:50647393-50647415 CCAGGAGGCTGGGCCAGGTGTGG + Intronic
925088358 2:1131938-1131960 AAAGGATTAGTGGCCAGGTGCGG - Intronic
925558158 2:5154534-5154556 CCCAGAGTCTTGGCCAGGTGTGG - Intergenic
925931765 2:8713874-8713896 CCAAAATTATTGGCCAGGAGCGG - Intergenic
926264293 2:11300552-11300574 CCATAGTTGTTGGCCGGGTGTGG - Intronic
926564945 2:14458864-14458886 CCAAAAATCTTGGCCAGGTGTGG + Intergenic
926911225 2:17853425-17853447 CCTGGATTGGGGGACAGGTGTGG - Intergenic
927523891 2:23720281-23720303 CCAGGAGGGCAGGCCAGGTGTGG + Intergenic
927774041 2:25888280-25888302 CAAGGATTGTTGACCAGGCACGG + Intergenic
928001433 2:27526242-27526264 GGACGAATGTTGGCCAGGTGTGG - Intergenic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
928439139 2:31277099-31277121 TAATGTTTGTTGGCCAGGTGTGG + Intergenic
929592710 2:43157628-43157650 CCAGGAATGCTGGCCTGGGGCGG - Intergenic
929746134 2:44660867-44660889 CCAGGTGTGGTGGCCAGGTGTGG - Intronic
930176406 2:48305478-48305500 CTAAGATTCATGGCCAGGTGCGG - Intergenic
930777156 2:55184393-55184415 ACAGGAATGTTGGCCAGGTGTGG - Intronic
931216357 2:60248659-60248681 CCAAGGTTGGTGACCAGGTGTGG - Intergenic
931434415 2:62234799-62234821 CCAGGGATGTGGACCAGGTGGGG - Intergenic
931513197 2:63022603-63022625 CTGGCAATGTTGGCCAGGTGCGG - Intronic
931598187 2:63973834-63973856 ACAGGATTGGTGGTCAGGTGTGG - Intronic
931718974 2:65053618-65053640 CCAGGATTCTTTGCCTGGTTGGG - Intergenic
932463114 2:71896038-71896060 ACAGGAGAGTTAGCCAGGTGTGG - Intergenic
933703034 2:85269596-85269618 CCAGTATTTTTGGCTGGGTGTGG - Intronic
935202495 2:100870187-100870209 TCAGGAGTCTGGGCCAGGTGCGG - Intronic
935525951 2:104167390-104167412 CCAAGATCTTTGGCCAGGAGAGG + Intergenic
935842415 2:107127999-107128021 CCATCATGGTTGGTCAGGTGTGG + Intergenic
935953933 2:108355674-108355696 AAAACATTGTTGGCCAGGTGCGG - Intergenic
936938928 2:117863070-117863092 TCACTATTTTTGGCCAGGTGCGG + Intergenic
937255012 2:120549128-120549150 CTATGATTGTTGGCCAAGTGTGG + Intergenic
937702414 2:124878971-124878993 AAAGTATTATTGGCCAGGTGTGG - Intronic
938834637 2:135088396-135088418 TTATGATTTTTGGCCAGGTGTGG + Intronic
939824277 2:146996040-146996062 AAAGAGTTGTTGGCCAGGTGCGG + Intergenic
940306878 2:152236422-152236444 GCAGGACAGCTGGCCAGGTGTGG - Intergenic
940384805 2:153058139-153058161 CCAGGAATGGCGGCCAGGTGTGG + Intergenic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
942315015 2:174689984-174690006 CCAGGATTGTGGGCAGGGAGGGG + Intergenic
942749646 2:179273441-179273463 CCAGGATTGGTAGTCAGGAGGGG - Intergenic
943794833 2:191979203-191979225 CCAGAATTGTTTTTCAGGTGGGG - Intronic
944341536 2:198606292-198606314 ACAAGATTCTTGGCCAGGCGTGG - Intergenic
945592703 2:211754148-211754170 TCAGGACTTTTGGCCAGGCGCGG - Intronic
945836235 2:214838805-214838827 CCATGATGGGTGGCCAGGTGCGG - Intergenic
946190069 2:218003303-218003325 CCAGGCTGGTTTGCCAGGGGCGG - Intergenic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946316651 2:218919730-218919752 AAGGGATTTTTGGCCAGGTGTGG - Intergenic
946495293 2:220190464-220190486 CCTGGGTTGGTGTCCAGGTGGGG - Intergenic
946702762 2:222429108-222429130 CCATGGTTCTTGGCCGGGTGCGG - Intronic
947626712 2:231623777-231623799 CAAGGCTTGGTGGGCAGGTGGGG - Intergenic
947956305 2:234195200-234195222 CCGGGATTGTGGGCCAAGTCTGG + Intergenic
948795531 2:240400419-240400441 AGAGGATTGGGGGCCAGGTGGGG + Intergenic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
949002455 2:241624067-241624089 CCTGGATTTGTAGCCAGGTGGGG - Intronic
1168916969 20:1497532-1497554 CCAGCACTTTTGGCCAGGCGTGG - Intergenic
1169004450 20:2195171-2195193 TGAGGATTTCTGGCCAGGTGCGG + Intergenic
1169280603 20:4263775-4263797 AAAGCAATGTTGGCCAGGTGTGG - Intergenic
1169345814 20:4827362-4827384 CAAGGATTACAGGCCAGGTGCGG + Intergenic
1169821927 20:9721355-9721377 GCAAGAATGTTGGCCAGGTGTGG + Intronic
1170257932 20:14366653-14366675 CAAAAATTGTTGGCCGGGTGTGG - Intronic
1172035592 20:32008528-32008550 CCAGGTGTCTTGGCAAGGTGTGG + Intergenic
1172447659 20:35001576-35001598 CCAGGGTCTGTGGCCAGGTGAGG + Intronic
1172464138 20:35143044-35143066 CTAAGACTTTTGGCCAGGTGCGG - Intronic
1172905792 20:38368307-38368329 AAAGCATTGCTGGCCAGGTGCGG + Intronic
1174356026 20:49998389-49998411 ACAGGATTTTTCGCCAAGTGAGG + Intergenic
1174383050 20:50169801-50169823 TAAGGATTCTGGGCCAGGTGCGG + Intergenic
1175443652 20:59006772-59006794 CCTGGCTTTCTGGCCAGGTGGGG + Intronic
1175790286 20:61736406-61736428 CCAGGCTGGGTGGACAGGTGGGG - Intronic
1175835966 20:61994667-61994689 CCAGGACTGTTGGAAATGTGTGG - Intronic
1175849449 20:62081072-62081094 TTATGAATGTTGGCCAGGTGCGG + Intergenic
1175869139 20:62199353-62199375 GTAGCATTGTTGGCCAGGCGTGG + Intronic
1176216454 20:63950286-63950308 ACAGGAAAGTTGGCCGGGTGTGG + Intronic
1178278584 21:31261419-31261441 CTTGGATTTTTGGCCGGGTGCGG + Intronic
1179216793 21:39374412-39374434 GAAAGATTGTTGGCCAGGTGCGG + Intergenic
1179710865 21:43212226-43212248 TCAGGATTGAAGCCCAGGTGTGG - Intergenic
1179877374 21:44276520-44276542 CTAGGATTCTGGGCCAGGTGTGG - Intergenic
1180681360 22:17629073-17629095 ACATGATTGTTGGCCGGGCGTGG + Intronic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181744439 22:24946017-24946039 CTATGGATGTTGGCCAGGTGTGG + Intronic
1182374941 22:29839733-29839755 ATATGTTTGTTGGCCAGGTGTGG - Intergenic
1183018445 22:35008546-35008568 CCAGGATGGATGGCCGGGTGTGG - Intergenic
1183022103 22:35035471-35035493 CCATGATTGATGGCCAGCTGTGG - Intergenic
1183309235 22:37100507-37100529 CCAGGTTTGCTGGCAAAGTGGGG + Intronic
1183406591 22:37633291-37633313 CCAGGAGTACGGGCCAGGTGAGG - Exonic
1183827470 22:40399749-40399771 CCAGGATGGCTGGCCTGTTGGGG + Intronic
1183889324 22:40913280-40913302 CCAACATAGTTAGCCAGGTGTGG + Intronic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
1184542428 22:45135709-45135731 TGAATATTGTTGGCCAGGTGTGG - Intergenic
1184579514 22:45405268-45405290 ACAAGATTCTTGGCCAGGCGCGG + Intronic
1184602787 22:45553332-45553354 CCAGGATGGGTGGCCTGCTGAGG + Intronic
1184984770 22:48122489-48122511 CTATGATTGTTGGCCAGGCATGG + Intergenic
1185037283 22:48486029-48486051 CCAGGACTGGTGGCTTGGTGTGG + Intergenic
1185401954 22:50623606-50623628 CAAATATTGTTGGCCAGGTGTGG + Intronic
950082514 3:10233340-10233362 CATGTATTGTAGGCCAGGTGCGG - Intronic
950184846 3:10938717-10938739 CTGGGGTTGTGGGCCAGGTGGGG + Exonic
950188127 3:10957923-10957945 CCAGGATTCCTGCCCAGGTCTGG - Intergenic
950310310 3:11952175-11952197 TCAGGATGGTTCTCCAGGTGAGG + Intergenic
952479682 3:33748332-33748354 CCATTATTGTTGGCTGGGTGTGG - Intergenic
952824669 3:37514854-37514876 CCAAGATTATTGGCCAGGCGTGG - Intronic
952880976 3:37986250-37986272 CCAGGCCTGATGCCCAGGTGTGG + Intergenic
953277151 3:41513345-41513367 TCAGCAGAGTTGGCCAGGTGTGG + Intronic
953976157 3:47382975-47382997 ACAGGAGTTTTGGCCAGGCGCGG - Intronic
954190054 3:48953218-48953240 TCAGAATTGCTGGCCAGGCGCGG - Intronic
954465466 3:50652031-50652053 TCAGGGCTGTTGGCCAGGTCAGG - Intergenic
954470872 3:50693976-50693998 ACAAAATTGTTGGCCAAGTGTGG + Intronic
954569529 3:51629004-51629026 ATAGTGTTGTTGGCCAGGTGTGG - Intronic
956364653 3:68487455-68487477 CTATGACTGTTGGCCAGGCGTGG + Intronic
956816966 3:72916476-72916498 CAAGAATTTATGGCCAGGTGTGG - Intronic
957458629 3:80487812-80487834 ACAGGAAAGGTGGCCAGGTGTGG + Intergenic
957618766 3:82567813-82567835 AAAAGATTTTTGGCCAGGTGTGG + Intergenic
957642993 3:82883260-82883282 TCAGGAGTGTTGGCGGGGTGGGG + Intergenic
958029263 3:88087363-88087385 CCAGGATTTTCAGCCAGGTGTGG - Intronic
958440327 3:94148455-94148477 CCTGGATTGGTGGGAAGGTGGGG - Intergenic
958516022 3:95117012-95117034 CAAGGGTTCTAGGCCAGGTGTGG - Intergenic
959680553 3:109091151-109091173 ACATGTATGTTGGCCAGGTGCGG + Intronic
960118345 3:113920830-113920852 CCCCGAATTTTGGCCAGGTGTGG - Intronic
961850188 3:129809034-129809056 CCAGGATGGTTAGCCAGGTCAGG - Intronic
961985712 3:131131090-131131112 CCAACATTGTAGGCCAGGCGTGG - Intronic
962296664 3:134195654-134195676 AAAGGAGTATTGGCCAGGTGCGG + Intronic
962932686 3:140052444-140052466 ACAGAAATATTGGCCAGGTGCGG - Intronic
963939380 3:151085190-151085212 CCATCATTCTTGGCCAAGTGCGG + Intergenic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
964574448 3:158149367-158149389 CAAGGGTTGCTGGCCAGCTGTGG + Intronic
965031868 3:163380709-163380731 ATAGGAATGTTGGCCGGGTGTGG + Intergenic
966160578 3:176963212-176963234 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
966380447 3:179339327-179339349 AGAGGGTTGTTAGCCAGGTGTGG + Intergenic
966874690 3:184315229-184315251 CCAGGAGTGTAGGCCAGGAAGGG - Intronic
966993964 3:185262232-185262254 CAAGAAGGGTTGGCCAGGTGCGG + Intronic
967462518 3:189762978-189763000 CAAGGACTGCTTGCCAGGTGTGG + Intronic
967489516 3:190074217-190074239 CTATGATTCTTGGCCAGGTGCGG + Intronic
967871383 3:194232659-194232681 CAATAATTGTAGGCCAGGTGTGG + Intergenic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
969778329 4:9376552-9376574 CCAGGACTGATGGGCTGGTGGGG - Intergenic
971124272 4:23735661-23735683 CATGGTTGGTTGGCCAGGTGCGG + Intergenic
972109449 4:35539166-35539188 CAAGGTTTGTTGACCAGGCGCGG - Intergenic
972675232 4:41254098-41254120 GCAGAATTCTTAGCCAGGTGTGG - Intergenic
974034203 4:56803127-56803149 CAAATAGTGTTGGCCAGGTGCGG + Intergenic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
976256068 4:83102239-83102261 TCATGATTCCTGGCCAGGTGTGG + Intronic
976657019 4:87499164-87499186 CCAAGATTTTAGGCCAGGTGCGG - Intronic
976818336 4:89175777-89175799 CCAGGGTTCTTGACTAGGTGGGG - Intergenic
977754237 4:100647815-100647837 TCTGGACTGTTGGCCAGGAGTGG - Intronic
977776906 4:100931581-100931603 CAAGAAGTATTGGCCAGGTGCGG + Intergenic
978157721 4:105509034-105509056 CTAGGATTGGTGGCCAGGCATGG - Intergenic
979405818 4:120309799-120309821 GCAGGACTGTTGGGAAGGTGTGG - Intergenic
980355374 4:131728838-131728860 TCTGGATGGTTGGGCAGGTGTGG + Intergenic
981196122 4:141922812-141922834 CAAAAATTGTAGGCCAGGTGCGG + Intergenic
982506735 4:156228035-156228057 CCAGACTTGGTGGCCAGGTGAGG + Intergenic
982541911 4:156682935-156682957 TCAAGATTCTAGGCCAGGTGTGG - Intergenic
982770645 4:159393696-159393718 CAAAGCATGTTGGCCAGGTGCGG - Intergenic
982896819 4:160941068-160941090 AAAGAATTGTTGGCCAGTTGCGG + Intergenic
982907231 4:161090251-161090273 TGAAGATTTTTGGCCAGGTGCGG - Intergenic
983220052 4:165035352-165035374 CCATAATTGTTGGCCAGGCACGG - Intronic
983232548 4:165143724-165143746 ACAGTATTGGTGGCCGGGTGTGG - Intronic
983241873 4:165242785-165242807 CAAGTATTCTTGGCCAGGAGTGG - Intronic
983614481 4:169686703-169686725 CCCATATTTTTGGCCAGGTGTGG - Intronic
986220699 5:5766471-5766493 CTAGGATGGTTGGCCGGGTGTGG + Intergenic
986794461 5:11195423-11195445 CCAGGATTGCTGTGCAGGTCTGG + Intronic
987240794 5:15996539-15996561 CCAGGATTTTTTGTCAGCTGAGG + Intergenic
987558177 5:19482404-19482426 CAATAATTTTTGGCCAGGTGCGG - Intronic
987605634 5:20132177-20132199 ACTTTATTGTTGGCCAGGTGTGG - Intronic
988874792 5:35432034-35432056 TGTGGATTGTTGGCCAGGGGAGG + Intergenic
989752792 5:44915872-44915894 CCTGGCTTGTTGGGGAGGTGGGG + Intergenic
989798238 5:45501908-45501930 CCATGTTGTTTGGCCAGGTGGGG + Intronic
990356336 5:54970061-54970083 CAAGGAATGTTGGCCAGTTCAGG - Intergenic
990468502 5:56091424-56091446 CAAGGTTTTTAGGCCAGGTGCGG - Intergenic
991262543 5:64682935-64682957 CATGGAAGGTTGGCCAGGTGCGG + Intergenic
991914451 5:71592088-71592110 ATAGGATCCTTGGCCAGGTGCGG + Intronic
992113944 5:73521976-73521998 CCAGCATTGCTGGCCAGGTACGG + Intergenic
992232716 5:74679508-74679530 GGAGGACTGTTGGCCAGGCGCGG + Intronic
992470870 5:77052060-77052082 TAAGAATTTTTGGCCAGGTGTGG + Intronic
992828687 5:80573177-80573199 CCAGGACTGGTGGGCAGGAGAGG + Intergenic
992843449 5:80719506-80719528 CCAGGATTGTCGACATGGTGGGG - Intronic
993513964 5:88806362-88806384 CCAGGATGTTTAGACAGGTGTGG - Intronic
993988648 5:94628119-94628141 AAAGTATTGTTGGCCAGGAGCGG - Intronic
994079303 5:95688536-95688558 GCATGATTTCTGGCCAGGTGTGG - Intronic
995320099 5:110824398-110824420 ACTGGATTGGAGGCCAGGTGGGG - Intergenic
995583830 5:113626151-113626173 CCAGGCTTCTGGGTCAGGTGGGG - Intergenic
996064830 5:119069070-119069092 CCAGGATTGTTGTACTTGTGTGG - Intronic
996077813 5:119218084-119218106 ACAAAATTATTGGCCAGGTGTGG + Intronic
996087404 5:119319116-119319138 AAAGTATTCTTGGCCAGGTGTGG + Intronic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
998066287 5:139161724-139161746 TTAGAATTGCTGGCCAGGTGCGG + Intronic
999395615 5:151225122-151225144 TTAGTATTATTGGCCAGGTGTGG - Intronic
999764220 5:154726128-154726150 CTTGAAATGTTGGCCAGGTGCGG - Intronic
1002396626 5:178961217-178961239 CTAAGATTGTGGGCCAGGTGTGG - Intronic
1002396645 5:178961523-178961545 ACAGCATTTTTGGCCAGGTGTGG + Intronic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1002513851 5:179742161-179742183 TTAAGTTTGTTGGCCAGGTGCGG - Intronic
1003028060 6:2576374-2576396 CCAGGGTTTTAGGCCAGGTGTGG - Intergenic
1004024134 6:11802831-11802853 ACAGGATTCTTAGCCAGGTGCGG + Intronic
1004048145 6:12046488-12046510 CCTGGGTTGCTGGCCAGGTGCGG + Intronic
1004718074 6:18238157-18238179 ACAAGATTCTAGGCCAGGTGTGG - Intronic
1004867839 6:19871306-19871328 GAAGGAAAGTTGGCCAGGTGTGG - Intergenic
1005686045 6:28253940-28253962 CTAGGAAAGTTGGCCAGGCGTGG - Intergenic
1006483260 6:34316152-34316174 CCAAGCTTTTGGGCCAGGTGTGG - Intronic
1006648408 6:35531531-35531553 CCCAGGTTCTTGGCCAGGTGCGG + Intergenic
1006764168 6:36490242-36490264 CAAGGGTTTTTGGCCAGGCGTGG + Exonic
1007230521 6:40344842-40344864 CCAGGACTGCGGGCCAGCTGGGG - Intergenic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1007703099 6:43775601-43775623 CCAGGCTTGTGGCCCAGGAGGGG - Intronic
1007752222 6:44077360-44077382 CCATGATGGCTGGCCTGGTGTGG - Intergenic
1008579016 6:52889016-52889038 TAGGGATTGTTGGCCAGGTGTGG + Intronic
1008736473 6:54550397-54550419 CCAGGGATTTTGGCCAGGTCTGG + Intergenic
1010376242 6:75174265-75174287 CTTGGATTCTTGGCCAGGCGCGG + Intronic
1010827276 6:80488411-80488433 TCAGTCTTGTTGGCTAGGTGCGG + Intergenic
1013119935 6:107132205-107132227 ACAGGATGTTTAGCCAGGTGCGG + Intergenic
1013322200 6:109004717-109004739 ATACGATTGTTGGTCAGGTGCGG - Intronic
1013743674 6:113319462-113319484 GAAGTATTATTGGCCAGGTGTGG + Intergenic
1015226355 6:130861579-130861601 TCAAAAATGTTGGCCAGGTGTGG + Intronic
1015629842 6:135220997-135221019 TCAAGATTGGTGGCCAGGTGCGG - Intergenic
1018289665 6:162279038-162279060 TCAGAAATGTTGGCGAGGTGAGG + Intronic
1019131605 6:169881050-169881072 CCAGGACTAAAGGCCAGGTGAGG - Intergenic
1019344822 7:524214-524236 CCAGGAGCGATGGCCACGTGTGG + Intergenic
1019557256 7:1638736-1638758 GCAGGGTTGGTGTCCAGGTGCGG + Intergenic
1019858992 7:3639268-3639290 CCAGCGTGGCTGGCCAGGTGAGG + Intronic
1020448350 7:8293859-8293881 GTAAGATTTTTGGCCAGGTGTGG + Intergenic
1021337100 7:19417133-19417155 ACAGGAATCTTGGCTAGGTGAGG + Intergenic
1022425024 7:30260723-30260745 CAAAGAATTTTGGCCAGGTGTGG + Intergenic
1023013342 7:35942452-35942474 TCAGTGTTGTTGGCCAGGTGCGG - Intergenic
1023256981 7:38322287-38322309 CCAGGATAGATGGGGAGGTGAGG + Intergenic
1023412371 7:39900779-39900801 CCTGGATTCCAGGCCAGGTGTGG - Intergenic
1023810713 7:43909434-43909456 CCAGTATTTTAGGCCAGGTACGG + Intronic
1024077789 7:45831380-45831402 TCAGTGTTGTTGGCCAGGTGCGG + Intergenic
1024094579 7:45973772-45973794 CTTAGGTTGTTGGCCAGGTGGGG + Intergenic
1024139367 7:46446192-46446214 CCAGGAAGGGTGGCCAGGGGAGG - Intergenic
1025678155 7:63659990-63660012 ACAGGAGTGTAGGCCAGGCGTGG - Intergenic
1026301372 7:69100987-69101009 TCTGGTTTATTGGCCAGGTGTGG - Intergenic
1026466897 7:70662064-70662086 CCAGAGATGTGGGCCAGGTGGGG + Intronic
1026634668 7:72070993-72071015 GCATGATTGTTGTCCAGGTGGGG - Intronic
1027171155 7:75873612-75873634 GCAACATTCTTGGCCAGGTGTGG + Intronic
1028558631 7:92149035-92149057 AAGGGATTTTTGGCCAGGTGTGG - Intronic
1029121699 7:98272450-98272472 TCCTGATTGTTGGCCAGGCGAGG - Intronic
1029187575 7:98750748-98750770 CAGGGGTTGATGGCCAGGTGTGG + Intergenic
1029280349 7:99431416-99431438 CTATTATTTTTGGCCAGGTGCGG - Intronic
1030096454 7:105904819-105904841 CCAAGATTTTTGGCCAGGCATGG - Intronic
1030148992 7:106383986-106384008 TCAAGAATGCTGGCCAGGTGCGG + Intergenic
1030701830 7:112648550-112648572 CCATCCTTGTTGGCCAGTTGGGG - Intergenic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1033849664 7:145479986-145480008 AGATGATTGTTGGCCAGGAGTGG - Intergenic
1033934878 7:146572007-146572029 AAAAGATTTTTGGCCAGGTGCGG - Intronic
1036275785 8:7350548-7350570 CCAGGACTGATGGGCTGGTGGGG - Intergenic
1036345570 8:7959810-7959832 CCAGGACTGATGGGCTGGTGGGG + Intergenic
1036840897 8:12120564-12120586 CCAGGACTGATGGGCTGGTGGGG + Intergenic
1036862704 8:12366814-12366836 CCAGGACTGATGGGCTGGTGGGG + Intergenic
1037032389 8:14125189-14125211 TCACTATTGTTGGCCAGGCGTGG + Intronic
1038992325 8:32881238-32881260 TCAGGTTTGCAGGCCAGGTGTGG - Intergenic
1039087464 8:33794167-33794189 ACAGGCTTGTTGGCCAGGCGCGG + Intergenic
1039458175 8:37721773-37721795 AGAAGATTCTTGGCCAGGTGCGG - Intergenic
1039828503 8:41194802-41194824 CCAGGAGTAATGTCCAGGTGAGG - Intergenic
1039988069 8:42464680-42464702 ACAGGAACTTTGGCCAGGTGCGG + Intronic
1040648095 8:49422229-49422251 CCAAGAGAGTTGGGCAGGTGAGG - Intergenic
1041074641 8:54158265-54158287 CAAGAATTCATGGCCAGGTGCGG - Intergenic
1041193125 8:55373455-55373477 TTTGGAGTGTTGGCCAGGTGCGG - Intronic
1041564903 8:59265596-59265618 CCACCATTAGTGGCCAGGTGCGG - Intergenic
1043503789 8:80882945-80882967 CTAGGCTTAATGGCCAGGTGTGG + Intergenic
1044975090 8:97656707-97656729 CCAGGAATTGAGGCCAGGTGCGG + Intronic
1047678443 8:127228203-127228225 CCAGGATTCTTGGTTAAGTGGGG - Intergenic
1049068181 8:140335996-140336018 AAAATATTGTTGGCCAGGTGCGG - Intronic
1049155753 8:141065817-141065839 CCAGGTTGATGGGCCAGGTGCGG - Intergenic
1049438703 8:142599436-142599458 GCAGGTTTGTTGGCCGGGAGAGG - Intergenic
1050615038 9:7392985-7393007 CCAAGATTTCTGGCCAGGCGTGG - Intergenic
1051268477 9:15331837-15331859 GAGGGATTGGTGGCCAGGTGTGG + Intergenic
1052479225 9:29000863-29000885 CCATGATTCTTGGGCATGTGTGG + Intergenic
1053449210 9:38179283-38179305 CCAGGAGTTTGGGGCAGGTGTGG + Intergenic
1053586395 9:39463565-39463587 TCAGAATTTTTGGCCAGGCGCGG - Intergenic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1055360502 9:75485067-75485089 CCATCGCTGTTGGCCAGGTGCGG + Intergenic
1055858717 9:80723514-80723536 GGAGGATTGTTGGGAAGGTGTGG - Intergenic
1055946165 9:81693096-81693118 CTATAATTATTGGCCAGGTGTGG - Intergenic
1057435770 9:95039274-95039296 CTGAAATTGTTGGCCAGGTGCGG + Intronic
1057587984 9:96346844-96346866 AAAGGATTTTTGGCCAGGCGTGG + Intronic
1058546037 9:106060807-106060829 ATAGGATATTTGGCCAGGTGTGG - Intergenic
1058860750 9:109115818-109115840 AGTGGATTGTAGGCCAGGTGCGG - Intronic
1060002412 9:119970373-119970395 ACAGAATCATTGGCCAGGTGTGG - Intergenic
1060163133 9:121385371-121385393 TAATGATTGCTGGCCAGGTGTGG + Intergenic
1061168160 9:128936527-128936549 CCAGGAGGGTGGGCCATGTGTGG + Intronic
1061271030 9:129542757-129542779 ACAGGATTGTTGGCTGGGTGTGG - Intergenic
1062033829 9:134373963-134373985 CCAGGCTGGGAGGCCAGGTGAGG - Intronic
1062095131 9:134699120-134699142 CCAGGATCGATGGACAGGAGGGG + Intronic
1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG + Intergenic
1062371516 9:136241600-136241622 CCGGGATGGGTGTCCAGGTGTGG - Intronic
1185594814 X:1299594-1299616 CAGAAATTGTTGGCCAGGTGTGG - Intronic
1186493574 X:9993990-9994012 ACAGTGTTGTTGGCCAGGCGTGG - Intergenic
1187253112 X:17617168-17617190 CCGGGTTTGTTGGCCAGGCTAGG + Intronic
1187351861 X:18526035-18526057 TCAATATTGTTGGCCGGGTGCGG - Intronic
1187428701 X:19202576-19202598 CCAGCATTGTGGGGCAGGGGTGG - Intergenic
1187551163 X:20307026-20307048 CCTGGATTGTGGTCTAGGTGGGG + Intergenic
1187760314 X:22576608-22576630 CCTGTGTTCTTGGCCAGGTGTGG + Intergenic
1187892171 X:23946572-23946594 ACAGCATGGTTGGCCAGGCGCGG + Intergenic
1188164334 X:26843279-26843301 CAAATATTGGTGGCCAGGTGCGG - Intergenic
1188372760 X:29389064-29389086 TTGTGATTGTTGGCCAGGTGCGG + Intronic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1188918815 X:35946161-35946183 AAAAGAATGTTGGCCAGGTGCGG - Intronic
1190791882 X:53708106-53708128 CCAGGCTATTTGGCCAGGCGCGG - Intergenic
1192333653 X:70200017-70200039 CCAAGATGGATGGGCAGGTGGGG + Intronic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1192817501 X:74610124-74610146 CTTGGATTGGTGGCCAGGCGCGG + Intronic
1192846587 X:74912204-74912226 CCAGCATGCTTAGCCAGGTGGGG - Intronic
1193828518 X:86257696-86257718 CAAGAGTTGTAGGCCAGGTGTGG - Intronic
1194250648 X:91570581-91570603 GTGGGATTGCTGGCCAGGTGTGG - Intergenic
1195281015 X:103332597-103332619 GCAGCAGTGTTGGGCAGGTGTGG - Intergenic
1195373242 X:104200781-104200803 CATGGATTTCTGGCCAGGTGCGG - Intergenic
1195931696 X:110084211-110084233 CAAGAATAGTTGGCCAGGTGTGG + Intronic
1198631563 X:138644568-138644590 CAAAGATTCCTGGCCAGGTGCGG - Intronic
1199681762 X:150229649-150229671 CCAAGAATGCTGGCCAGCTGAGG - Intergenic
1199853164 X:151739558-151739580 CTAGGATAGTTCGCCTGGTGGGG + Exonic
1200569592 Y:4811830-4811852 GTGGGATTGCTGGCCAGGTGTGG - Intergenic
1200780427 Y:7210679-7210701 CCAGTCTTCTTAGCCAGGTGTGG + Intergenic
1200947459 Y:8859992-8860014 ACAGACTTTTTGGCCAGGTGTGG + Intergenic
1201374335 Y:13300270-13300292 TCCGTATTGTTGCCCAGGTGTGG + Intronic