ID: 928058861

View in Genome Browser
Species Human (GRCh38)
Location 2:28088771-28088793
Sequence ATGTTTATTCCTAATCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928058861 Original CRISPR ATGTTTATTCCTAATCCATT TGG Intronic
905903287 1:41596406-41596428 AGGTTTTTTGCTAATCCAATGGG + Intronic
906851603 1:49256967-49256989 ATTTTATTTCCTAATCTATTTGG - Intronic
908341963 1:63190697-63190719 ATGTGTTTTCTTTATCCATTAGG - Intergenic
909752154 1:79175961-79175983 ATGTTTCTTCTTAAACTATTAGG + Intergenic
909829584 1:80170501-80170523 ATGTGTTTTACTAATGCATTTGG - Intergenic
911846169 1:102753313-102753335 ATATTTATTCTTAATTCTTTAGG - Intergenic
912916205 1:113817187-113817209 ATCTCTATTCCTAGTCCACTTGG - Intronic
915824489 1:159060237-159060259 ATGAATATTCCTTATCCGTTAGG - Intergenic
916532419 1:165670116-165670138 ATTTTGATTCCTGATACATTTGG - Intronic
916586953 1:166157318-166157340 GTGTTGATTCCTAATCCGTATGG + Intronic
917162368 1:172072172-172072194 TTGTATACTCCAAATCCATTTGG - Intronic
917200367 1:172508285-172508307 CTGTTTCTTCCTATTCCTTTGGG + Intergenic
918472804 1:184892149-184892171 ATGATTACTACTAACCCATTGGG - Intronic
918595238 1:186285641-186285663 ATGTGTATTCATAATCTAATTGG - Intergenic
919648846 1:200125125-200125147 ATGTTTATTCATAAGCTCTTTGG + Intronic
920741976 1:208589596-208589618 ATCTTTATTAATAATGCATTTGG - Intergenic
921085300 1:211785419-211785441 ATTTTTATTACTAATCTATCGGG + Intronic
922147020 1:222956577-222956599 ATGTTTCTCCCTAATGCATAGGG + Intronic
922694680 1:227723446-227723468 ATATTTATCCCTTATGCATTTGG + Intergenic
923095376 1:230771258-230771280 ATGTTTTATCCTCATGCATTTGG - Intronic
923421422 1:233819437-233819459 AGCTTTATTCCTATTCCATCAGG - Intergenic
1066693609 10:38058316-38058338 ATGTTTCTTTCTAATCCTTTTGG - Exonic
1066999193 10:42590729-42590751 ATATTTCTTTCTAATCCTTTTGG + Exonic
1068586178 10:58801492-58801514 TTGTTTATTCCAAATCACTTTGG + Intronic
1071001508 10:80836263-80836285 ATTTATAATCCTAATCCTTTGGG + Intergenic
1072695619 10:97600802-97600824 ATGCTTGTTCCTATTCCATCTGG + Intronic
1073926300 10:108520130-108520152 ATCTTTTTTCCTTATCCATTTGG - Intergenic
1074251815 10:111758189-111758211 ATATTTATTCCTGTTTCATTAGG - Intergenic
1078940531 11:15999909-15999931 ATTTTTGTTTCTAATGCATTCGG - Intronic
1079113066 11:17617384-17617406 ATATTTATTCCTTAAACATTTGG + Intronic
1080634785 11:34114215-34114237 ATGTTCCTTCGTCATCCATTAGG - Intronic
1082870030 11:57935762-57935784 CTGATTATTCCTGAACCATTCGG + Intergenic
1086670478 11:89540394-89540416 ATGTTTATTGCTCATATATTAGG + Intergenic
1086803163 11:91202707-91202729 ACTTTTTTTCCTAATCCTTTTGG + Intergenic
1087403473 11:97697892-97697914 ATGTTATTTTCTAACCCATTTGG + Intergenic
1087407037 11:97743578-97743600 ATATTTATCCCTTATGCATTTGG - Intergenic
1087522147 11:99252478-99252500 TTTTTTTTTCCTAAGCCATTTGG - Intronic
1090310882 11:125737523-125737545 TTGATTATTCATAATCCATTTGG - Intergenic
1090734289 11:129597899-129597921 ATTTGGATTCTTAATCCATTTGG - Intergenic
1094002566 12:25711218-25711240 ATATTTATCCCTTATGCATTTGG + Intergenic
1094532796 12:31292979-31293001 AAGTATATTCCTAACCTATTTGG + Intronic
1095380037 12:41580035-41580057 ATGTTCATTCTTAATTCATGTGG - Intergenic
1096376675 12:51117619-51117641 ATATTTTTTACTAATCCTTTTGG - Intronic
1096479685 12:51930737-51930759 ATGGGTATTCCTATGCCATTTGG + Intergenic
1097772635 12:63606035-63606057 ATTTTTCTTCCTAATACATAAGG + Intronic
1098332500 12:69368685-69368707 ATGTTTTTTCCAAAGCCTTTAGG + Intronic
1099134597 12:78880171-78880193 ATGATTTTTCCTCATCCATGTGG + Intronic
1100090548 12:90963962-90963984 AGGTTTATTCCTAACTCATCTGG + Exonic
1100620476 12:96267034-96267056 ATAATTATTGCAAATCCATTGGG - Intronic
1102140087 12:110607606-110607628 ATATTTTCTCCTATTCCATTGGG - Intergenic
1103098400 12:118150825-118150847 CTGTTTATTCTTACTCCATCAGG - Exonic
1104012081 12:124938944-124938966 ATATTTATTCCTTATGCATGAGG - Intergenic
1108796433 13:54037024-54037046 ATTTTTATTGCTAATATATTGGG - Intergenic
1108977576 13:56467973-56467995 ATGTTTATTCTTCAACCAATAGG + Intergenic
1109069443 13:57745966-57745988 ATGATTATGCCTACTTCATTAGG + Intergenic
1109403781 13:61870733-61870755 ATGTTTAATCCCAATGCTTTGGG - Intergenic
1109690569 13:65882584-65882606 ATTTTTATTGCTAACTCATTTGG + Intergenic
1109800173 13:67366352-67366374 ATGTTGACTCCCATTCCATTAGG - Intergenic
1109827434 13:67740911-67740933 ATGTTTATTCCTTGTCTGTTAGG - Intergenic
1109905824 13:68839846-68839868 ATGTTTATTTCTTTCCCATTGGG + Intergenic
1110015144 13:70390793-70390815 ATTTTTCTTCCCAATTCATTTGG + Intergenic
1110431530 13:75429577-75429599 ATTTTTCTTCCAAATCAATTTGG + Intronic
1110937734 13:81313640-81313662 ATTTTTAGCCCTCATCCATTCGG + Intergenic
1112159826 13:96855509-96855531 ATGTTTCTTCCAATTCAATTGGG + Intergenic
1114227470 14:20752282-20752304 GTTTTTATTCCTAATGCAATTGG - Intergenic
1114295517 14:21325701-21325723 AGGTTTCTTCCTGATCCAGTTGG + Intronic
1115125047 14:29982003-29982025 TTGTTTATTGGTAATCCATAAGG - Intronic
1116589902 14:46759316-46759338 AAGTATATTTCTAATCCTTTTGG + Intergenic
1118009744 14:61598272-61598294 ATTTTTATTTTTAAGCCATTTGG + Intronic
1119938315 14:78614083-78614105 CTGTTTGTTACTAATCCATAAGG + Intronic
1120256453 14:82125807-82125829 ATGTTTACTCCAAATCTTTTTGG + Intergenic
1121135733 14:91496839-91496861 AGGTTTATTCCTAGTCTATTGGG + Intronic
1121882699 14:97514921-97514943 ATGATTCTTCCTGATCCAGTGGG + Intergenic
1121927853 14:97945596-97945618 TTGTTTATTCCCAATGTATTGGG - Intronic
1122497223 14:102166402-102166424 ATGTATATTCCTTATCTGTTAGG + Intronic
1124058900 15:26269257-26269279 ACTTGTATTTCTAATCCATTTGG + Intergenic
1128602197 15:69005712-69005734 ATATTTATCCCTTATGCATTTGG + Intronic
1129009646 15:72403812-72403834 ATGATTATTCCTAATAGACTTGG + Intronic
1131426485 15:92349307-92349329 ATGTATATGTCTAATCCAGTAGG - Intergenic
1131576804 15:93600537-93600559 ATGTTTAAACCTAAGCCATATGG + Intergenic
1131989406 15:98078825-98078847 ATCTTTTTTCCTCTTCCATTAGG + Intergenic
1132267449 15:100486921-100486943 ATGTTTATTAATAATTCATTGGG - Intronic
1133466881 16:6035910-6035932 ATGTCTATTCTTAAAGCATTTGG + Intronic
1134035398 16:11026538-11026560 ATTTTTTTTCCTAATCATTTTGG + Intronic
1135474499 16:22762403-22762425 ATGCTCATTCTTAATCCCTTGGG + Intergenic
1139077454 16:63469768-63469790 ATGTATATTCATACTCCAGTAGG + Intergenic
1139257552 16:65557398-65557420 ATGTTTACTCCTAACCCAAGGGG - Intergenic
1150901118 17:69278705-69278727 ATTTTTATTCCAAATACATTTGG - Intronic
1152665643 17:81567533-81567555 ATGTTTATTCCCATTCCTCTAGG - Exonic
1154523984 18:15263081-15263103 TTGTTTGTTCTTATTCCATTGGG + Intergenic
1155628976 18:27869070-27869092 ATTTTTTTTTCTAATTCATTTGG - Intergenic
1158938690 18:62387491-62387513 ATGCTTATTCCTAATCTTTATGG + Exonic
1159040393 18:63318862-63318884 ATTTTTATTCCAATTCCTTTCGG + Exonic
1159832640 18:73295961-73295983 ATGTTTATCCCGAATGCTTTGGG - Intergenic
1163210721 19:15837868-15837890 CTATTTATTCCTAATCGAATGGG + Intergenic
1167415494 19:49369068-49369090 ATATTTATCCCTTATGCATTGGG - Intronic
1167983379 19:53295046-53295068 ATTCTTATTCCTAACGCATTGGG + Intergenic
925474810 2:4201409-4201431 AAGTTTCTTCCTAATCTATCTGG + Intergenic
928058861 2:28088771-28088793 ATGTTTATTCCTAATCCATTTGG + Intronic
932759310 2:74429062-74429084 ATGTTCATTCCTAACCCTCTGGG - Intronic
933055828 2:77663505-77663527 ATGTTTATCTCTCATCCATAGGG + Intergenic
933181247 2:79230154-79230176 ATGTTAATTCCCAATACAATGGG + Intronic
935003088 2:99041192-99041214 ATGTTTATCTCTTATGCATTTGG - Intronic
936993920 2:118393899-118393921 ATGTTTGTTCCTATTTCATTTGG + Intergenic
937039765 2:118812165-118812187 ATGTTTTTTACTAATCCATTTGG - Intergenic
937765539 2:125656468-125656490 TTGTTTATTCTTTTTCCATTAGG - Intergenic
937804538 2:126123582-126123604 ATTTTTTTTCCCAATCCACTGGG + Intergenic
938413595 2:131086073-131086095 ATGTTTATTCCTAAACTGTAGGG - Intronic
939281287 2:140068766-140068788 ATGTTTCTTCATACTCCTTTTGG + Intergenic
940556973 2:155241133-155241155 ATTATTATTATTAATCCATTTGG - Intergenic
941888882 2:170557538-170557560 ACCTTTATTCCTCATTCATTAGG + Intronic
942073035 2:172332436-172332458 ATTTCTATCCCAAATCCATTTGG + Intergenic
942906785 2:181192040-181192062 ATGATTATTCCTATTTCATTAGG + Intergenic
943332998 2:186583017-186583039 ATTTTTATTCTTAACCTATTTGG - Intergenic
943342990 2:186703585-186703607 CTGGTTATAGCTAATCCATTAGG - Intronic
943409527 2:187529549-187529571 ATGTTCAATCCTAATTCAGTAGG - Intronic
943977192 2:194498930-194498952 ATGTTTCTTACTGATTCATTTGG - Intergenic
945616920 2:212082706-212082728 ATGCTTTTTCCTAACCCTTTAGG - Intronic
947125823 2:226867417-226867439 AGGTTTATTCTTTATCTATTAGG + Intronic
947888507 2:233595389-233595411 ATGTTAATCCCTAATACAATGGG + Intergenic
947888726 2:233596782-233596804 ATGTTAATCCCTAATACAATGGG + Intergenic
948444595 2:238022630-238022652 ATGTTTAATTTTAATGCATTTGG + Intronic
1169542444 20:6614680-6614702 TTGTCTATTCCTAATGCCTTTGG - Intergenic
1169777250 20:9269067-9269089 AGGCTTATTCCTAATACTTTAGG + Intronic
1171944124 20:31360970-31360992 ATGATTATTACTGATACATTTGG - Intergenic
1172210793 20:33197115-33197137 ATGTAAATTCATAACCCATTTGG - Intergenic
1176773450 21:13105407-13105429 TTGTTTGTTCTTATTCCATTGGG - Intergenic
1179259911 21:39749048-39749070 ATGTTTATGCCTTATGCATATGG + Intronic
1179364683 21:40746748-40746770 ATGTGTATTCTGAATCTATTGGG - Intronic
1182959715 22:34460669-34460691 TTTTTTTTTCCTAAACCATTTGG + Intergenic
1183681929 22:39336428-39336450 ATCTGTAATCCCAATCCATTGGG + Intergenic
1184575229 22:45358565-45358587 ATATTTCTTCCAAAACCATTAGG + Intronic
949118187 3:354905-354927 TTGTTTATTTCTAAGCAATTTGG + Intronic
951107671 3:18764227-18764249 ATTTTTACTCCTAATCAATCTGG + Intergenic
951414513 3:22407779-22407801 ATTTTTATTCCAATTCCATTTGG + Intergenic
952466526 3:33593445-33593467 ATGTTTTTTCCTAATTAATATGG - Intronic
953471579 3:43171390-43171412 ATTTTCTTTCCTAATACATTTGG - Intergenic
953843583 3:46409126-46409148 ATGTTTATTCTTCTTGCATTTGG - Exonic
955591100 3:60536678-60536700 ATATTTATTCTGAATCCAGTTGG - Intronic
955746628 3:62147114-62147136 ATGTTGATTCCTACTTCATAGGG + Intronic
957317831 3:78591313-78591335 ATGTCTAGTCTTAATCTATTTGG - Intergenic
957443202 3:80279907-80279929 TTGTTTATTTTTAATCCGTTTGG + Intergenic
957463233 3:80550575-80550597 ATGTTTATTGCTGATGCACTAGG + Intergenic
961232642 3:125331269-125331291 ATGTTTAATCCTGATTCTTTTGG - Intronic
963169049 3:142232648-142232670 ATATTTATTCCTTACACATTGGG + Intergenic
963658875 3:148098177-148098199 ATGTATATTTTTAATCCATCGGG - Intergenic
964463062 3:156958312-156958334 ATTTTTCTTCCCAATTCATTTGG + Intronic
964868962 3:161292126-161292148 CTGTTAATTCCTAATGCAGTTGG - Intergenic
964945445 3:162218054-162218076 ATTTTGATCCCTAATACATTTGG + Intergenic
965717620 3:171623881-171623903 ATTTTTATCTCTGATCCATTTGG - Intronic
966308711 3:178569144-178569166 CTATTTATTCCTAATACATGGGG - Intronic
967187369 3:186956280-186956302 AGCTTTATTCTTAACCCATTTGG + Intronic
970255258 4:14162024-14162046 ATTTAGATCCCTAATCCATTTGG + Intergenic
970329908 4:14970030-14970052 ATGTTTATTCATCATCTATTTGG - Intergenic
972463899 4:39333645-39333667 ATGTTTATACCTATAACATTAGG - Intronic
972719129 4:41678238-41678260 TTTTTTTTTCCTAATCCTTTTGG + Intronic
972848495 4:43019215-43019237 TTGTTTATTCATTATTCATTTGG + Intronic
977643487 4:99384288-99384310 ATGTTTATTCTTAATCTTATGGG + Intergenic
978960064 4:114666265-114666287 CTGTTTAGTCCTAAATCATTGGG + Intronic
979199963 4:117965459-117965481 ATGTGTATTTATAATCTATTGGG + Intergenic
980150134 4:129036231-129036253 ATGTTTATTCCTAGTACAATAGG - Intronic
980937398 4:139239398-139239420 ATATTTATCCCTTATGCATTTGG + Intergenic
981035116 4:140161374-140161396 ATGTTTATTTTTAATTCAATGGG + Intergenic
981855147 4:149280454-149280476 ATGTTTACTCCTAATTTCTTGGG - Intergenic
982185787 4:152797113-152797135 ATCTAGATTCCTAATCCATTTGG + Intronic
982634161 4:157870994-157871016 ATGTTCATTCCTGATTAATTTGG - Intergenic
983540442 4:168903700-168903722 TTGTGTATTCCTACTCTATTTGG - Intronic
983818374 4:172161299-172161321 ATATTTTTTCTTAATCCACTTGG + Intronic
984197920 4:176681732-176681754 ATGTTTATTTATATTCCTTTTGG + Intergenic
984801442 4:183720822-183720844 ATTTTTTTTCCTCATCCACTAGG + Intergenic
985905579 5:2832936-2832958 ATGTTTTTCTCTAAACCATTAGG + Intergenic
990762800 5:59149260-59149282 ATGTTTCTTCTTAATCACTTAGG + Intronic
992898373 5:81267800-81267822 ATGATTATACCTATTGCATTGGG + Intergenic
993757741 5:91751714-91751736 ATGGATTTTCCTTATCCATTTGG - Intergenic
993788026 5:92168230-92168252 ATGTTTACTCTTAAGCCCTTTGG - Intergenic
994797038 5:104317069-104317091 ATATTTATTCCTTACACATTTGG - Intergenic
994966623 5:106680677-106680699 GTTGATATTCCTAATCCATTAGG - Intergenic
995842348 5:116454705-116454727 CAGTTTATTCCTAAGCCATCTGG - Intronic
997655607 5:135552090-135552112 GTGTTTATTAATCATCCATTGGG + Intergenic
998359752 5:141574680-141574702 GTTTTTATTCCTAATTTATTAGG + Intronic
999209130 5:149872513-149872535 ATGTTTCTTCCTGAAACATTTGG + Intronic
1000413221 5:160956023-160956045 ATGTTTGTTCCTTTTCTATTGGG - Intergenic
1000453067 5:161414931-161414953 ATGTTTATTCCTGAGCTTTTTGG - Intronic
1000477542 5:161729936-161729958 GTGTTTATTCTTTTTCCATTTGG - Intergenic
1000640311 5:163694618-163694640 GTTTTTATTCATGATCCATTTGG + Intergenic
1000755152 5:165149068-165149090 ATATTTCTTCCTCATCTATTGGG + Intergenic
1002488348 5:179555145-179555167 ATGTTTGTTACTCATCCTTTAGG - Intronic
1004045914 6:12022480-12022502 ATTTTTATAGCTTATCCATTTGG + Intronic
1007153272 6:39716870-39716892 ATGTTCAGTCCAAAACCATTAGG + Intronic
1008300490 6:49832435-49832457 ATGTTTATCCTAAATTCATTTGG - Intergenic
1008730654 6:54479013-54479035 ATGTTCTTTTTTAATCCATTAGG + Intergenic
1008844594 6:55948273-55948295 ATTTAGATTGCTAATCCATTTGG - Intergenic
1010053000 6:71530436-71530458 GTGTTTATTCCTAATATTTTAGG + Intergenic
1010385255 6:75272565-75272587 ATATTTATCCCTTATGCATTTGG - Intronic
1011073306 6:83409471-83409493 GTGTTTATTCCTAACCAATCAGG - Intronic
1011919259 6:92550459-92550481 CTGTGTATTCCTAATTCTTTGGG + Intergenic
1012008489 6:93748489-93748511 CTCTGTATTACTAATCCATTTGG + Intergenic
1012397148 6:98811532-98811554 ATGTTCATGCCTAAACCAGTTGG - Intergenic
1012803386 6:103864319-103864341 ATGTGTATTGCTAATATATTTGG - Intergenic
1013178256 6:107695369-107695391 ATGTTGATTACTATTTCATTAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014330069 6:120052953-120052975 ATGTAGATCTCTAATCCATTTGG - Intergenic
1014926401 6:127276322-127276344 ACTTTTATTCCTAATCCCTTTGG - Intronic
1016301943 6:142642336-142642358 ATTGTTATTCCTATTCAATTAGG - Intergenic
1016707587 6:147129750-147129772 ATGTTTATTGTTAAAACATTAGG - Intergenic
1018720636 6:166569374-166569396 ATGTTTACTCCCATTTCATTCGG + Intronic
1019683196 7:2364716-2364738 ATATTTTTTCCTGAGCCATTTGG + Intronic
1021070127 7:16227883-16227905 ATTTAAATCCCTAATCCATTTGG + Intronic
1021432385 7:20575465-20575487 AGATTTATTCCTAATTCTTTTGG + Intergenic
1022365596 7:29712620-29712642 ATTTTTCTTCCTAATACATAAGG - Intergenic
1022695922 7:32705531-32705553 ATTTTTCTTCCTAATACATAAGG + Intergenic
1022932195 7:35129726-35129748 ATTTTTCTTCCTAATACATAAGG + Intergenic
1023023652 7:36032576-36032598 ATGTTTATTCATGGTCCCTTTGG + Intergenic
1023789465 7:43741669-43741691 ATATAGATTCTTAATCCATTTGG - Intergenic
1024186682 7:46955791-46955813 ATTTAAATTCCTAATCCATCTGG + Intergenic
1024963196 7:54999405-54999427 ATGTTAATTACCAATCCAATAGG - Intergenic
1025733089 7:64123734-64123756 ATGTTTGTTCATAAAACATTGGG + Intronic
1027521724 7:79216739-79216761 AACTTTTTTCCTAATCCCTTGGG + Intronic
1027841541 7:83318598-83318620 CTGTTTATTATTAATTCATTGGG + Intergenic
1028009819 7:85627562-85627584 GTGTTTGTTCCTAAAACATTGGG + Intergenic
1030239028 7:107299279-107299301 CTGTTTTTTCCTAATCCATCTGG - Intronic
1030414465 7:109224432-109224454 GTGTTCCTTCCTCATCCATTTGG + Intergenic
1030886687 7:114947296-114947318 ATGTCTTTTCCTCCTCCATTTGG + Intronic
1033611373 7:142966411-142966433 ATTTTTCTTCCTAATCCAACAGG + Intergenic
1034024379 7:147683040-147683062 ATTTTAATTCTTATTCCATTTGG - Intronic
1037056969 8:14454879-14454901 ATGTATATGCCTAATCCATTTGG - Intronic
1037101369 8:15051276-15051298 ATATTTATTCTTAATGCATCTGG + Intronic
1038236593 8:25764007-25764029 ATCTTGATTTTTAATCCATTTGG + Intergenic
1038262733 8:26011425-26011447 ATGTTTATTGGGAATCCAATAGG - Intronic
1039365447 8:36923678-36923700 ATATTTATCCCTTATGCATTTGG + Intronic
1040098453 8:43473616-43473638 CATTTTATTCCTCATCCATTTGG - Intergenic
1040621169 8:49094873-49094895 ATATTTATCCCTTATGCATTTGG - Intergenic
1040696353 8:50004314-50004336 ATGTTTATTCCTAGTTAATTTGG + Intronic
1040773734 8:51013077-51013099 ATGTTTATTCCATGTCTATTGGG + Intergenic
1041074232 8:54154594-54154616 ATGATTAATCCTAATGCATATGG + Intergenic
1041086808 8:54264255-54264277 ATTTGTATTTCTTATCCATTTGG + Intergenic
1041127379 8:54657385-54657407 ATGTTTATTAATAAACCATAAGG - Intergenic
1041334539 8:56765968-56765990 GGGTTTTTTCCTAATCCCTTGGG + Intergenic
1041626274 8:60030998-60031020 ATGTTTATTTGCAAACCATTTGG + Intergenic
1041873069 8:62657338-62657360 ATGTTTAATTATAATTCATTTGG + Intronic
1042056817 8:64772746-64772768 ATTTTTATTCCTAATGAAATGGG - Intronic
1042448570 8:68918477-68918499 ATTTTCAGTCCTCATCCATTTGG - Intergenic
1042883796 8:73524743-73524765 GTTTCTATTCATAATCCATTTGG - Intronic
1043659686 8:82722558-82722580 ATATTTTTTCCTAATATATTAGG - Intergenic
1044844255 8:96364786-96364808 AAGTTTTTTCATAATTCATTTGG - Intergenic
1045421643 8:102022356-102022378 ATGTTTATTCCAAATACTTGAGG + Intronic
1046109977 8:109710983-109711005 ATGTTTATTCATAAATCATCTGG - Intergenic
1046151712 8:110235194-110235216 ATTTTTTTTCCTAATACAATGGG - Intergenic
1046433716 8:114160966-114160988 ATGTACATTCCTATTCCACTTGG - Intergenic
1046998665 8:120551874-120551896 ATATTTAATCCTAATCCTATGGG - Intronic
1047444989 8:124911726-124911748 ATATTTATCCCTTATACATTTGG - Intergenic
1047472367 8:125189260-125189282 ATGTTTATCCCTTATGCATTTGG + Intronic
1050098484 9:2093271-2093293 ATGCTTATTAGTAATCCATTGGG + Intronic
1050378992 9:5005733-5005755 ATGTTTCTTCCTCAGACATTTGG + Intronic
1050415489 9:5412301-5412323 ATTTAGATTCCAAATCCATTTGG - Intronic
1050418132 9:5435642-5435664 ATTTTTATTCTTAATCCAACTGG + Intronic
1050451890 9:5790429-5790451 ATTTTTATTACTCATACATTTGG - Intronic
1050839639 9:10132128-10132150 ATGATTATTCTTAAGACATTGGG + Intronic
1051135897 9:13919978-13920000 AAGCTTATTCTTCATCCATTCGG - Intergenic
1052218120 9:25990662-25990684 ATGTTAATTCTTAAGACATTGGG - Intergenic
1052253047 9:26422691-26422713 AAGTTTATTCCTATTACATGGGG - Intergenic
1056300611 9:85236786-85236808 ATGTTTATTCAAAATCCTCTTGG + Intergenic
1058236293 9:102494324-102494346 TAATTTATTCATAATCCATTGGG + Intergenic
1058335355 9:103821616-103821638 ATTTTTATTCTTAAGTCATTGGG - Intergenic
1058370098 9:104256430-104256452 ATATTTATCCCTTATGCATTTGG - Intergenic
1059818456 9:117945125-117945147 ATATTTATTCCTAATTAAATGGG + Intergenic
1060134012 9:121133818-121133840 ATTTTTTTTCCTGAACCATTTGG + Intronic
1187085201 X:16035362-16035384 ATGTTTCTTCCAAATCAAATAGG - Intergenic
1187705559 X:22006286-22006308 ATCTTTATTCCCCACCCATTTGG + Intergenic
1189645583 X:43126168-43126190 ATTTTTATTCCTGATACATAAGG - Intergenic
1191871097 X:65746130-65746152 ATTTTTATTCTTATTCCACTTGG + Intergenic
1193113178 X:77750466-77750488 ATGTTTATACCTCCTCCCTTAGG - Intronic
1196093245 X:111770107-111770129 ATGTTTATTCCAAATTTATGAGG + Intergenic
1196514387 X:116552288-116552310 ATTTTAATTCATTATCCATTTGG + Intergenic
1198054864 X:132983906-132983928 ATTTTTCTTCTTAATACATTAGG + Intergenic
1198252667 X:134895889-134895911 GAGTTTTTTCCTAGTCCATTAGG - Intronic
1198863640 X:141097014-141097036 ATGTTAATTAGTATTCCATTGGG - Intergenic
1198899047 X:141490363-141490385 ATGTTAATTAGTATTCCATTGGG + Intergenic
1199701505 X:150380659-150380681 ATTTAGATTCCTAATCCATTTGG + Intronic
1200635700 Y:5651018-5651040 ATTTTTATTTCCAATCCCTTGGG - Intronic