ID: 928064024

View in Genome Browser
Species Human (GRCh38)
Location 2:28145035-28145057
Sequence CTTTAGATTCAGAATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928064024_928064030 -4 Left 928064024 2:28145035-28145057 CCACCCACATTCTGAATCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 189
Right 928064030 2:28145054-28145076 AAAGTTCTGGGTGTGGTTTTAGG 0: 1
1: 0
2: 1
3: 25
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928064024 Original CRISPR CTTTAGATTCAGAATGTGGG TGG (reversed) Intronic
902455141 1:16528087-16528109 TTTTAGAATCATAAGGTGGGTGG + Intergenic
903000656 1:20263167-20263189 CAGTTGGTTCAGAATGTGGGTGG + Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907336859 1:53705337-53705359 ATTTAGATGCAGAGTGAGGGAGG - Intronic
907874969 1:58476894-58476916 CTTTGGAGTCAGAAGATGGGAGG + Intronic
907998392 1:59655992-59656014 CTTTATATTCATAATCTAGGAGG + Intronic
908102143 1:60802197-60802219 CTTTAGATTCAGTATATCTGGGG + Intergenic
908834182 1:68211984-68212006 CTTTGTAATCAGAATGGGGGAGG - Intronic
909173253 1:72321877-72321899 AATTAGATTCAGGATTTGGGAGG - Intergenic
911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG + Intergenic
911713364 1:101100113-101100135 CATTAGATTCAGAATCTGAATGG - Intergenic
912074381 1:105853793-105853815 CTCAAGATTAAGAATTTGGGGGG - Intergenic
912803040 1:112733430-112733452 ATTTTGATTTAGAATGTGGGAGG - Intergenic
916489704 1:165290825-165290847 CTTCTGACTCAGAAGGTGGGTGG - Intronic
916724956 1:167515301-167515323 CTTTGGCTTCAGAATCTAGGTGG + Intronic
918184965 1:182119071-182119093 ATTTAGATTCAGACAATGGGAGG + Intergenic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
920704323 1:208240746-208240768 CTTTATGATCAGAATGGGGGTGG + Intronic
920785693 1:209039043-209039065 CTTTAGATTCATATGGTGGAAGG + Intergenic
920976567 1:210791351-210791373 CTATAGATTCAGAACCTGTGGGG + Intronic
921084198 1:211772147-211772169 CTGTTGATTCACAATATGGGAGG - Intronic
921535100 1:216339468-216339490 ATGTAAATGCAGAATGTGGGAGG + Intronic
921652785 1:217698458-217698480 ATTTAGTGTCAGAATGTGGCTGG + Intronic
922889436 1:229048933-229048955 CATCAGATTCATATTGTGGGAGG + Intergenic
923624882 1:235605939-235605961 TTTTTGATTGAGAGTGTGGGGGG + Intronic
924000467 1:239545314-239545336 TTAGAGATTCAGAGTGTGGGAGG + Intronic
1063055324 10:2497885-2497907 CTCTAGATACAGAATGTTGTAGG + Intergenic
1063560721 10:7124195-7124217 CTTTGGATTCAGAATGAGAATGG + Intergenic
1064139831 10:12781109-12781131 CTTTAGATACTTGATGTGGGAGG + Intronic
1066804927 10:39238336-39238358 CTTTGGATTCAGTATTTTGGAGG + Intergenic
1067688669 10:48485383-48485405 CGTTAGTTTCCGAATTTGGGGGG + Intronic
1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG + Intergenic
1069427356 10:68300547-68300569 ATTCTGATTCAGAATGTCGGAGG - Intronic
1070885383 10:79892121-79892143 CTTTAGATTGGGAAGGTGGGGGG - Intergenic
1074501934 10:114033571-114033593 CTTTGGTTTGAGAATGTGGAGGG - Intergenic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1076370165 10:129947617-129947639 CTTTATATTCAGAATTTAAGTGG - Intronic
1077067670 11:650435-650457 CCTTAGAGACAGAATGTGGTTGG - Intronic
1081054827 11:38396666-38396688 TTGTAGATTCAGAATCTGGTTGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1083547067 11:63556737-63556759 CCGTAGATTCAGGGTGTGGGAGG - Intronic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1086411540 11:86549418-86549440 CTTTAGAGTCAGGTTGTGGTAGG - Intronic
1088048005 11:105477057-105477079 CTTTGGATTAAGATTGTGGGTGG + Intergenic
1088906348 11:114158068-114158090 CTTAAGGTTCAGAGTGTGGCGGG + Intronic
1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG + Exonic
1090494235 11:127194072-127194094 CTTTTGATTCAGTACATGGGTGG - Intergenic
1091092650 11:132787030-132787052 CTATAGATTCAGAATCTCAGGGG - Intronic
1091095662 11:132819886-132819908 CTCTAGAGTCAGAATGCGGCAGG + Intronic
1091539327 12:1444931-1444953 GTTTAGATTCAAGATTTGGGGGG + Intronic
1091898548 12:4124086-4124108 CTTTAGAGTCAGAATAGGTGCGG - Intergenic
1092126504 12:6078546-6078568 CTCTAGTTTCAAATTGTGGGTGG - Intronic
1092977877 12:13763371-13763393 CTTTGGATTGAGTACGTGGGAGG - Intronic
1093225487 12:16478632-16478654 TTTTAATTTCAGAAAGTGGGAGG + Intronic
1096772316 12:53943778-53943800 CTATAGTTTCAAAATGTGGTAGG + Intronic
1107103716 13:36621860-36621882 CTTTTGATCCAGAAAGAGGGAGG - Intergenic
1107262484 13:38511447-38511469 CTTTACCATCAGAATCTGGGTGG + Intergenic
1108648517 13:52453281-52453303 CATCTGATTCAGAAGGTGGGAGG - Intergenic
1108748939 13:53426469-53426491 TTTTAGATTCAGAAGGTACGTGG + Intergenic
1109408782 13:61937094-61937116 CTCTGGCTTCAGAATGTTGGCGG + Intergenic
1110302192 13:73941868-73941890 ATTTAGATTCTGCATGTTGGAGG - Intronic
1111078381 13:83268729-83268751 CTTTAAAATGAGAATGTGAGAGG + Intergenic
1114056936 14:18978337-18978359 CATTAGGTTCTGAATATGGGGGG - Intronic
1114105610 14:19423409-19423431 CATTAGGTTCTGAATATGGGGGG + Intronic
1115137623 14:30129942-30129964 CTTTAGATTTGGCCTGTGGGAGG + Intronic
1115770392 14:36660385-36660407 CTTTAGAATCGGAATCTTGGGGG - Intronic
1115838305 14:37435048-37435070 CTTTAAATTCACAAAGTAGGTGG - Intronic
1116609187 14:47045609-47045631 TATTAGATTGAGAATGTTGGAGG + Intronic
1117023222 14:51593939-51593961 CTTTTGCTTCAGAAAGTAGGGGG - Intronic
1117180390 14:53185438-53185460 CTGTAGATTCAGGGTCTGGGAGG + Intergenic
1117620400 14:57580272-57580294 CATTAGTTTCAGCATTTGGGAGG + Intronic
1117730118 14:58713868-58713890 ATTGTGGTTCAGAATGTGGGGGG - Intergenic
1118461933 14:65995340-65995362 CTTCAGAGTTAGATTGTGGGAGG - Intronic
1125879260 15:43178443-43178465 CTTTAAATTCAGAATTTGGCAGG - Intronic
1126132431 15:45354770-45354792 ATTTAAATTAAAAATGTGGGAGG + Intergenic
1130238382 15:82161437-82161459 TTTTACATTCAGAATGTCTGGGG - Intronic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132813050 16:1810933-1810955 CTTAGGATTGAGAATGTTGGTGG - Intronic
1134619948 16:15680277-15680299 TACTATATTCAGAATGTGGGGGG + Intronic
1135893806 16:26380315-26380337 ATTTAGCTTCAGAAGGTAGGTGG + Intergenic
1137575560 16:49597696-49597718 CTCTAGAATCATAATGTTGGGGG - Intronic
1140997370 16:80274279-80274301 CTTTTGCTTCAGTATGTGAGTGG - Intergenic
1145087666 17:19956364-19956386 CTTCGGATTCAGACTGTTGGTGG - Intronic
1146601440 17:34220554-34220576 CTACTGAATCAGAATGTGGGGGG - Intergenic
1149642324 17:58211195-58211217 CCTAAGATTCACAATGTAGGGGG + Intronic
1149868420 17:60162994-60163016 GTTTAGATTCAGCATCCGGGTGG + Intronic
1151817943 17:76480681-76480703 TTTTAAATTCAGAATGAGGCTGG - Intronic
1153438907 18:5095540-5095562 ATCTAGATTCAGAATTTGGCTGG + Intergenic
1155332403 18:24731564-24731586 CATTTGATCCAGACTGTGGGTGG - Intergenic
1156029852 18:32700088-32700110 CCTTAGATGTAAAATGTGGGAGG - Intronic
1157695972 18:49723978-49724000 CTGTTGACTGAGAATGTGGGAGG - Intergenic
1158012880 18:52748833-52748855 TTATAGGCTCAGAATGTGGGAGG + Intronic
1158273847 18:55745218-55745240 ATTTGGGTTGAGAATGTGGGGGG + Intergenic
1159843224 18:73425603-73425625 TTTTGGATTCAGAGTGTGAGAGG - Intergenic
1162530871 19:11235811-11235833 CTTTATATTTGGAAAGTGGGCGG - Intronic
1163655349 19:18542602-18542624 TGTTAGATTCAGAGTGTGGAAGG - Intronic
1165222474 19:34328126-34328148 CTTAAGTTTCAGATTGTCGGCGG - Exonic
1165351083 19:35276353-35276375 CTTAAAATTCAGAAGCTGGGTGG - Intronic
1165665823 19:37627131-37627153 ATTCAGATTCAGAAAGTTGGTGG - Intronic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
929409344 2:41679193-41679215 CTTTTGATTTAGTATGTGGTTGG + Intergenic
929903023 2:46022304-46022326 CTTTAGAATCAGATTCTGGAGGG - Intronic
931023762 2:58083748-58083770 ATATAGATCCAAAATGTGGGGGG - Intronic
935332534 2:101987676-101987698 CTTTAGACTCATAATGAAGGTGG - Intergenic
936232357 2:110714056-110714078 CTATAGATTCAGGATGTTAGAGG + Intergenic
938737911 2:134203294-134203316 CTTGAGATTCAGCAAGTGTGAGG + Intronic
940278009 2:151959711-151959733 CTTTATATTTGGAATGTGGGAGG + Intronic
940895866 2:159081439-159081461 CTGTGGATTGAGAATGTGGCAGG + Intronic
942125882 2:172824576-172824598 CTTTAGAGTCAGAATCTGTGGGG + Intronic
1169736876 20:8847183-8847205 CTTCAGAATCAGAATGTCTGAGG - Intronic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175856567 20:62123527-62123549 CTTTAGAGTCAGAATCTCTGAGG + Intronic
1176965928 21:15211339-15211361 TCTTTGATTCAGTATGTGGGGGG + Intergenic
1177650747 21:23958376-23958398 CTTTAAATTCACAATGTGCCTGG - Intergenic
1179006312 21:37518480-37518502 TTTTAGATTCAGAGTTGGGGTGG + Intergenic
1180475423 22:15700949-15700971 CATTAGGTTCTGAATATGGGGGG - Intronic
1181336021 22:22129591-22129613 ATTTAGATTCAGAAGATGGTGGG + Intergenic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1182439675 22:30355827-30355849 CTTTGGGTTCAGAATAAGGGGGG - Intronic
1182641246 22:31769619-31769641 CTTTAAATTCAAAAAGTGGCTGG + Intronic
949405328 3:3707953-3707975 ATTTAGCTTTAGAATGTGGCTGG + Intronic
950647909 3:14388601-14388623 CATTAAAATCAGAATGTGTGGGG + Intergenic
953598598 3:44340747-44340769 CTGCAGAATCAGAATCTGGGTGG - Intronic
955224529 3:57050040-57050062 CTCTGGATTCAAAATCTGGGTGG - Intronic
959367645 3:105482993-105483015 CCTTAGATTGAGAATCAGGGGGG - Intronic
959376331 3:105592978-105593000 ATTAAGTTTCAGAATGTTGGAGG + Intergenic
959551850 3:107668982-107669004 CTTTAACCTCTGAATGTGGGAGG - Intronic
959860573 3:111210668-111210690 TTTTAGATTGGGAATGGGGGTGG + Intronic
960339053 3:116453063-116453085 CTTTAGATTCTGGAGGAGGGAGG + Intronic
960889469 3:122432252-122432274 CTCTAGAATCAGAATTTTGGAGG + Intronic
962076637 3:132088876-132088898 CATGAGAGTAAGAATGTGGGAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965426790 3:168535028-168535050 CTATAGATTCTGACTGCGGGTGG - Intergenic
967817117 3:193809055-193809077 CTTAAGAGTCAGAATTTGGTAGG + Intergenic
968280163 3:197471147-197471169 CTTTAGCTTATGAATTTGGGTGG + Intergenic
971956573 4:33427833-33427855 CTCTAGATTCAGAATGCCTGCGG + Intergenic
973115366 4:46451128-46451150 GTTTAGAAGCAGAATGTAGGTGG + Intronic
975180535 4:71339213-71339235 CTTTAGATTGGGGATTTGGGAGG + Intronic
980342824 4:131572557-131572579 CTTTACATTAAGAAAATGGGTGG + Intergenic
984264476 4:177480770-177480792 CTATAAACCCAGAATGTGGGGGG - Intergenic
989849483 5:46191308-46191330 GTTTTGATTCAGAAGTTGGGAGG + Intergenic
990098066 5:52144210-52144232 CTTTAAATTATGAATGTGGCTGG + Intergenic
990314797 5:54573987-54574009 TTTCAGCTTCTGAATGTGGGTGG - Intergenic
993847169 5:92958398-92958420 CTTAAGATTCAGAATAAGTGAGG - Intergenic
998546110 5:143029221-143029243 GATTAAATTCAGAATGAGGGAGG + Intronic
1003398193 6:5770981-5771003 ATTTGGATTCAGCAGGTGGGAGG - Intronic
1006190060 6:32202122-32202144 CTTCAGAGTCACACTGTGGGTGG + Exonic
1007940813 6:45779594-45779616 CTTTAGAGTCAGAATGGCTGAGG - Intergenic
1008784384 6:55148379-55148401 TTTTAGATGAATAATGTGGGAGG - Intronic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1009665034 6:66666391-66666413 TTTTAGAATCAGAATGTTGTTGG + Intergenic
1010490061 6:76465191-76465213 CCTTAGATGGAGAATGTAGGAGG - Intergenic
1010984475 6:82407804-82407826 CTTTAAATTTGGAATGTTGGAGG + Intergenic
1012795862 6:103760275-103760297 TTTTAGATTCTGAATGTGAGTGG - Intergenic
1013277250 6:108597373-108597395 CTTATGATTCTGAATGTGGAAGG + Intronic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016262960 6:142195813-142195835 CTTTAATTTCAGAATGTTTGAGG + Intronic
1016753534 6:147658674-147658696 CTTTCAAGTCAGAACGTGGGTGG + Intronic
1022872072 7:34490144-34490166 CTTTTGCCTAAGAATGTGGGGGG + Intergenic
1022970852 7:35515496-35515518 CTTTAGATACCTAATGTGGGTGG + Intergenic
1024354340 7:48399004-48399026 CTTTGGATTTAGTATGTGGAGGG + Intronic
1024676318 7:51640972-51640994 CATGAGATTCAGAATGTTCGGGG - Intergenic
1025875520 7:65477157-65477179 AATTAGAATCAGAATCTGGGTGG - Intergenic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1028445080 7:90913049-90913071 CTTTAGAAAAAGAATGTGTGTGG + Intronic
1031453689 7:121953830-121953852 CATTAGGTTCAGATGGTGGGTGG - Intronic
1031611368 7:123831788-123831810 CTGTAGATTCTGAAAGTGGTTGG + Intronic
1032252166 7:130267363-130267385 CTTTAGATTCAGCACCTAGGTGG + Intronic
1033282715 7:140017358-140017380 GTTTAGACTCTGATTGTGGGTGG + Intronic
1035636723 8:1152742-1152764 CGTTAGCTTCAGCATCTGGGAGG - Intergenic
1035640240 8:1179254-1179276 CCTTAGATGCAGAGTGGGGGTGG + Intergenic
1035823701 8:2621761-2621783 CTTTAGATTTGGAATGTTAGAGG + Intergenic
1039619917 8:38987376-38987398 ATTTAGACTCAGAAGGTTGGCGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040117903 8:43645968-43645990 CTTTTGATTCAGAAGGTTTGTGG + Intergenic
1040649597 8:49433401-49433423 CTTTTGCTTCATAATGAGGGTGG - Intergenic
1041291954 8:56316497-56316519 CTCTGTATTCAGAAAGTGGGAGG + Intronic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1042868503 8:73377036-73377058 CTTGAGGTTGAGAAAGTGGGTGG - Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1048790861 8:138102029-138102051 CTTCAGGTTCAGAATCTGGATGG + Intergenic
1050376927 9:4984183-4984205 CTTTAAATGCATAATGTGCGGGG - Intergenic
1056753267 9:89366907-89366929 CTTGAGACTAAGAATCTGGGTGG + Intronic
1057159619 9:92879517-92879539 CTTTAGCTTGCTAATGTGGGGGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1186905169 X:14102802-14102824 ATTTAGATTCAGAATTGGTGAGG + Intergenic
1186922423 X:14296654-14296676 CTGTAGCTTCAGAAAATGGGTGG - Intergenic
1186950292 X:14617040-14617062 CTTTAGTTTAAGAATGTTGTTGG + Intronic
1188604016 X:32006008-32006030 CTTTAGCTTTAGACGGTGGGTGG + Intronic
1190136708 X:47805180-47805202 CTTTAGAACCAGAAGGTGGCTGG - Intergenic
1191240981 X:58189921-58189943 CTTTATCTTTAAAATGTGGGAGG - Intergenic
1193120254 X:77815910-77815932 CTTGAGAGTCTGAAGGTGGGAGG - Intergenic
1197956895 X:131960757-131960779 AATTAGAGTCAAAATGTGGGGGG + Intergenic
1199590456 X:149463156-149463178 CTTTAGCTAAAGAATGTGAGTGG - Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic