ID: 928065464

View in Genome Browser
Species Human (GRCh38)
Location 2:28160240-28160262
Sequence GTCCTGGAATCCCAGGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2854
Summary {0: 1, 1: 0, 2: 4, 3: 90, 4: 2759}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065464_928065473 29 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065464_928065469 3 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065469 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 7
2: 110
3: 548
4: 1762
928065464_928065472 28 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065464_928065467 -7 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065467 2:28160256-28160278 CCAGGACTAGCCACTGCGCCTGG 0: 1
1: 0
2: 2
3: 59
4: 1051

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065464 Original CRISPR GTCCTGGAATCCCAGGTTTT TGG (reversed) Intronic