ID: 928065465

View in Genome Browser
Species Human (GRCh38)
Location 2:28160247-28160269
Sequence GTGGCTAGTCCTGGAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065465_928065473 22 Left 928065465 2:28160247-28160269 CCTGGGATTCCAGGACTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065465_928065472 21 Left 928065465 2:28160247-28160269 CCTGGGATTCCAGGACTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065465_928065469 -4 Left 928065465 2:28160247-28160269 CCTGGGATTCCAGGACTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 928065469 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 7
2: 110
3: 548
4: 1762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065465 Original CRISPR GTGGCTAGTCCTGGAATCCC AGG (reversed) Intronic