ID: 928065468

View in Genome Browser
Species Human (GRCh38)
Location 2:28160266-28160288
Sequence CCAATCATGGCCAGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5700
Summary {0: 2, 1: 3, 2: 102, 3: 845, 4: 4748}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065468_928065473 3 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065468_928065477 28 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065468_928065474 14 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065468_928065472 2 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065468 Original CRISPR CCAATCATGGCCAGGCGCAG TGG (reversed) Intronic
Too many off-targets to display for this crispr