ID: 928065470

View in Genome Browser
Species Human (GRCh38)
Location 2:28160274-28160296
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 425}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065470_928065474 6 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065470_928065477 20 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065470_928065472 -6 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065470_928065473 -5 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065470 Original CRISPR ACTAAAAACCAATCATGGCC AGG (reversed) Intronic