ID: 928065471

View in Genome Browser
Species Human (GRCh38)
Location 2:28160279-28160301
Sequence AATATACTAAAAACCAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065471_928065474 1 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065471_928065473 -10 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065471_928065477 15 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065471 Original CRISPR AATATACTAAAAACCAATCA TGG (reversed) Intronic
903432081 1:23312651-23312673 AATTAATTATAAACCAATCAGGG + Intronic
904109633 1:28115530-28115552 AATACACTAAAAATCAGTAAGGG + Intergenic
904864333 1:33565220-33565242 AATATACTGAAAACAAATCTTGG + Intronic
905706389 1:40062967-40062989 AATAAAATAAAAAACAATTAGGG - Intronic
906232281 1:44174176-44174198 TTTTTACTAAAGACCAATCATGG + Intergenic
906349935 1:45049959-45049981 AATATACTGACAACTAATTATGG + Intronic
906548942 1:46645346-46645368 AATATTTTAAAAACCAAATATGG - Intronic
906846612 1:49199668-49199690 AAAATTCTAAAAGCCAATTATGG - Intronic
908197567 1:61760288-61760310 AACATATTGAAAACCAATAACGG - Intronic
909023436 1:70457557-70457579 GATATACTAAAAACCACACCAGG - Intergenic
910566959 1:88654670-88654692 AAAAGACTAAAATCAAATCATGG + Intergenic
910756102 1:90692643-90692665 ATTAAAGTTAAAACCAATCAAGG + Intergenic
911226449 1:95311002-95311024 AATAAAATAAAAACCAAAAAAGG - Intergenic
911280274 1:95917179-95917201 AATATACTAAAAAATACTGAGGG + Intergenic
911455183 1:98113275-98113297 AATATTCTAAAACCCAGGCATGG + Intergenic
911468306 1:98282995-98283017 AATATATAAATAACCATTCAAGG - Intergenic
911845076 1:102742447-102742469 ATTACAATAAAAACCTATCAAGG + Intergenic
911868921 1:103065861-103065883 AATCTACTGAAAAGCAAACACGG + Intronic
912003510 1:104863733-104863755 AATATAATAAAAAACAGGCAGGG - Intergenic
912003523 1:104864063-104864085 TATATACTTAAAACAAGTCATGG - Intergenic
912087147 1:106022328-106022350 AATCTACTAAACAACATTCAAGG + Intergenic
913506212 1:119518169-119518191 AATGTATCAAAAGCCAATCAGGG + Intergenic
914372313 1:147038387-147038409 AATATACTAAAGAACCCTCAAGG + Intergenic
914577197 1:148984457-148984479 AATATACTAAAGAACCCTCAAGG - Intronic
914878297 1:151528707-151528729 AATATAATAAAAACCACTGGGGG - Intronic
915209982 1:154301349-154301371 AATATTTTAAAAACCAATTTTGG + Intergenic
916386928 1:164284398-164284420 ATTAAACTAAAAACTAATAACGG + Intergenic
917596156 1:176531284-176531306 AATACACTGAAAACCAATGATGG - Intronic
918283953 1:183033852-183033874 AAAATACAAAAAACCTAGCAGGG - Intronic
918640512 1:186835445-186835467 AATTTATTGAAAAGCAATCAGGG + Intronic
918875690 1:190039762-190039784 TATATACTACAAACCAAAGAGGG - Intergenic
919526420 1:198658102-198658124 AAGAAACTAAAAACCAAATAAGG - Intronic
920813869 1:209312766-209312788 AAAATACTAAGAACCATTTAGGG - Intergenic
921510254 1:216019522-216019544 AATAAACTAAGATCCAATGAGGG - Intronic
921631851 1:217442852-217442874 AATATAGTAAAAATAAATCTAGG - Intronic
922166740 1:223122019-223122041 AAGAAAATAGAAACCAATCAGGG + Intronic
922673117 1:227529474-227529496 GAAATACTAAAAATCATTCAAGG - Intergenic
922810369 1:228412023-228412045 AAAATAACAAAAAGCAATCAGGG - Intronic
923351921 1:233115845-233115867 AATATACTAAAGACAAATATTGG + Intronic
923560767 1:235039377-235039399 ATTTAACTAAAAACCAGTCATGG + Intergenic
923801359 1:237212762-237212784 ATAATAATAATAACCAATCATGG - Intronic
924427026 1:243961038-243961060 AAAATAATAAAAACTAAACAAGG + Intergenic
1063512415 10:6658731-6658753 AATATACTAAAAACCACTGTGGG - Intergenic
1065602819 10:27387257-27387279 AAGATAGTAAAAACCCATTAAGG + Intergenic
1066501205 10:35996524-35996546 TATATATCAAAAACCAATTACGG - Intergenic
1068091547 10:52438567-52438589 AACAAAATAAAAAACAATCATGG - Intergenic
1068158166 10:53228158-53228180 AATATACCTCAAACCAATAAAGG + Intergenic
1068191469 10:53657848-53657870 ATTATAATAAATACTAATCATGG - Intergenic
1068406766 10:56599771-56599793 AATACAATAAAAACCCATGAGGG + Intergenic
1068697092 10:59979444-59979466 AAAATACTGAAAACAAATCTGGG - Intergenic
1068808984 10:61234342-61234364 TTTCTACTAAAAACAAATCATGG - Intergenic
1069122097 10:64579267-64579289 AGTATAATAAAAAAAAATCATGG + Intergenic
1069468752 10:68666943-68666965 AATAAACTAAAATATAATCATGG + Intronic
1070221495 10:74451254-74451276 AAATCACTAAAAAGCAATCAGGG - Intronic
1071689928 10:87806369-87806391 AATATAATCAATACCAATCCAGG + Intronic
1071697824 10:87896701-87896723 AATATAATGTGAACCAATCAAGG - Intronic
1072081468 10:92036899-92036921 AATCTACTAAAATCCACACAAGG + Intergenic
1072833966 10:98691292-98691314 AATACCCTAAAAAGCAAGCAGGG - Intronic
1073689194 10:105788484-105788506 AAAATACTAAAAGCAAATCTAGG + Intergenic
1073738466 10:106379015-106379037 ATTTTACTAAAGACAAATCATGG - Intergenic
1074091706 10:110265847-110265869 AACATGATAAAAACCAATTACGG - Intronic
1074197625 10:111203213-111203235 AAGATACTACACACCACTCATGG + Intergenic
1074224569 10:111471885-111471907 AAATTATTAAAAACAAATCAGGG - Intergenic
1075135588 10:119782688-119782710 AATAAAATAAAAACAAATAAAGG + Intronic
1077937763 11:6807416-6807438 CATATACAAAAATCAAATCAAGG - Intergenic
1078702560 11:13701741-13701763 AATACACTGAAAACCCATAAAGG - Intronic
1079400073 11:20099623-20099645 AAGACACTAAAAACCACTCAAGG + Intronic
1080516224 11:33023320-33023342 AATATACAAATAAACAATAAAGG + Intronic
1082974130 11:59055461-59055483 AATATTTTAAAAACCTATAATGG + Intergenic
1083214782 11:61211586-61211608 AATATATTAAAAACAAATGCAGG + Intronic
1083217666 11:61230415-61230437 AATATATTAAAAACAAATGCAGG + Intronic
1083220662 11:61250165-61250187 AATATATTAAAAACAAATGCAGG + Intronic
1084551715 11:69847471-69847493 AGTAAAATAAAAACCCATCAAGG + Intergenic
1084910707 11:72386448-72386470 CAAATACTAAAAAACTATCAAGG - Intronic
1085538126 11:77239186-77239208 AATATACCAAAATACAATAAAGG + Intronic
1085676212 11:78521318-78521340 AAAAAACCAAAAACCAAGCATGG - Intronic
1085837960 11:79976577-79976599 AATATTCTAAACACAAATCAAGG + Intergenic
1086459563 11:86992871-86992893 AATATAATAGAAACTAAACATGG + Intergenic
1087295061 11:96362417-96362439 AACAAACAAAAAACCAAACAAGG - Intronic
1088915942 11:114227823-114227845 AAAAAATTAAAAACCAATCCTGG - Intronic
1090322127 11:125856048-125856070 AATAAAATAGAAATCAATCACGG + Intergenic
1090503960 11:127289463-127289485 AAAATACGAAAAAGCAATGAGGG + Intergenic
1094175768 12:27539372-27539394 AATATCCTAAAAACTAATAATGG - Intronic
1095367908 12:41430121-41430143 AGTGTACTAGAAACCAATAATGG - Intronic
1095428835 12:42111125-42111147 AATATTTTAAAAAACAATCCAGG + Intronic
1097759080 12:63439832-63439854 AATATAATAAAATCCAAGTAAGG + Intergenic
1098209228 12:68145295-68145317 AATATAATAATAACAAATAAAGG + Intergenic
1098477751 12:70924904-70924926 AAAATACTAAAAAATAATAATGG - Intergenic
1098517752 12:71397473-71397495 AATACAATAAAAATCACTCAAGG + Intronic
1098584575 12:72140863-72140885 AATATTCTTAAAACAAATCTGGG + Intronic
1099670493 12:85685744-85685766 AATATGCTAAAATCCAAGTAAGG + Intergenic
1099911719 12:88841942-88841964 AGTTTACTAAAGACAAATCATGG + Intergenic
1100293750 12:93241311-93241333 AATATACTACAATCCAACAAAGG + Intergenic
1102047455 12:109838713-109838735 ACTATACTAAAAACCACTGAAGG + Intergenic
1103540568 12:121663741-121663763 AAAATAAAAAAAACCAATAAAGG - Intronic
1104183965 12:126410427-126410449 AATATACTGTAATCCAGTCATGG + Intergenic
1104236539 12:126943861-126943883 AATATTCTGAAATCCATTCAGGG + Intergenic
1105294919 13:19079680-19079702 AATATATTAAAAAAAAGTCAGGG + Intergenic
1105653857 13:22411989-22412011 AACATAAAAGAAACCAATCATGG - Intergenic
1105778523 13:23685413-23685435 TTTTTACTAAAAACAAATCACGG - Intergenic
1106148684 13:27076175-27076197 AAAGCACTAAAGACCAATCAAGG + Intronic
1107285298 13:38783655-38783677 AATATACTAAACACCTTTCTAGG + Intronic
1107863948 13:44685472-44685494 AAAATGCTAAAAGCCAATCATGG + Intergenic
1108509655 13:51144950-51144972 ATTTTACTAAAGACAAATCATGG - Intergenic
1108767919 13:53657217-53657239 TGTATACTAAAAACCAATCTTGG + Intergenic
1108816924 13:54304262-54304284 AATATACAAAAAAATGATCAGGG - Intergenic
1109328189 13:60895586-60895608 AATATTTTAAATGCCAATCAAGG - Intergenic
1109381240 13:61562031-61562053 AATATAATAAAAACAGATTAAGG + Intergenic
1110011283 13:70337357-70337379 AATATAATAAAAAAAAGTCAAGG + Intergenic
1110477439 13:75932999-75933021 AAGATACTGAATACTAATCATGG - Intergenic
1110964976 13:81682947-81682969 AATTTAATTAAAACTAATCAGGG - Intergenic
1111576963 13:90167304-90167326 ATTATACCAAAAACAAATCATGG + Intergenic
1111836275 13:93392325-93392347 AATAAAGTAAAAAACAATTAGGG - Intronic
1112444002 13:99446908-99446930 AAAAAACTAAAAACTAAACATGG - Intergenic
1112849768 13:103691112-103691134 AACACAGTAAACACCAATCATGG + Intergenic
1113035616 13:106045124-106045146 CCTATACTAAAAACCAAGCATGG + Intergenic
1113712061 13:112472338-112472360 CATATACAAAAATCAAATCAAGG + Intergenic
1114565226 14:23626847-23626869 TTTTTACTAAAAACAAATCATGG - Intergenic
1114693052 14:24602791-24602813 AATATACAAAGAAACAATCTGGG - Intergenic
1115033976 14:28835047-28835069 TATAGACTAAAAACCCATCTTGG + Intergenic
1115183593 14:30658050-30658072 GATATAATAAAAAAGAATCAGGG - Intronic
1115251608 14:31354456-31354478 AATACACTATTAACTAATCAAGG + Intronic
1115350883 14:32394526-32394548 AATAGACCAAAGAACAATCAAGG + Intronic
1115537012 14:34382827-34382849 AATATACTAAAAAGTAATGCTGG + Intronic
1115563515 14:34604682-34604704 AATACACTAAAAACGAAATATGG + Intronic
1116006101 14:39292824-39292846 AATCAACTAAAAAAAAATCAAGG - Intronic
1116329881 14:43582362-43582384 TTTTTACTAAAAACAAATCATGG - Intergenic
1116388945 14:44367991-44368013 AAAAAACTAAAAAGCAATCCAGG + Intergenic
1118699371 14:68418027-68418049 AATAAAATAAAAACAAAACACGG + Intronic
1119295610 14:73530633-73530655 AACAAACAAAAAACAAATCAAGG - Intronic
1119795006 14:77388286-77388308 CATATACTAAAAGAGAATCAGGG + Intronic
1120360721 14:83498483-83498505 AATTAACCAAAAACAAATCATGG - Intergenic
1121712898 14:96052538-96052560 AATATTTCATAAACCAATCAAGG + Intronic
1123671159 15:22659905-22659927 AATATACAAAAGACAAATTAGGG - Intergenic
1124049394 15:26181139-26181161 AAAATATTAAACACTAATCAAGG - Intergenic
1124323199 15:28733130-28733152 AATATACAAAAGACAAATTAGGG - Intronic
1124443887 15:29711326-29711348 AATATTCTGAAAACATATCATGG + Intronic
1125856851 15:42958483-42958505 AATATACCATACTCCAATCATGG + Intronic
1126154749 15:45555439-45555461 AATAAACAAATAATCAATCATGG - Intergenic
1127980420 15:64030698-64030720 AATTTAATAAAAATCAATCCAGG - Intronic
1128889278 15:71316554-71316576 AATATACTACACACCAACCTAGG + Intronic
1128955698 15:71941062-71941084 AATATACTAAACACTTATGATGG + Intronic
1129093439 15:73177151-73177173 AGTATAGTAAAAAGCAATTATGG - Intronic
1130795573 15:87205291-87205313 AATATATGAAAAATCAAGCATGG - Intergenic
1130804349 15:87303110-87303132 AAAATAATAAATACCATTCAAGG - Intergenic
1132048042 15:98581830-98581852 AATATAAGAAAAAAAAATCAAGG - Intergenic
1132057032 15:98660097-98660119 AAAATAATAAAAGGCAATCATGG - Intronic
1132164525 15:99572818-99572840 AATATTCTAAATACCTAACATGG - Intronic
1133343062 16:5050766-5050788 AACACATTAAAAACCATTCATGG + Intronic
1136450156 16:30349941-30349963 AATATACAAAAAACCACTGAAGG + Intergenic
1138226610 16:55301162-55301184 ACTATACTAAAATCTAATAATGG - Intergenic
1138960038 16:62018230-62018252 AATATACTAAAAACAGATGATGG + Intronic
1141258824 16:82431845-82431867 AATACTCTATAAAGCAATCATGG - Intergenic
1143073543 17:4319003-4319025 AACAGACTAAAAACAAATCATGG + Intronic
1143169490 17:4919523-4919545 AATATACCAAGAAGCTATCATGG + Intergenic
1143185830 17:5009477-5009499 AATATAGTAAGAACCCATAATGG - Intronic
1144368088 17:14563952-14563974 AAAATACTACATACAAATCAGGG + Intergenic
1145869798 17:28264643-28264665 ATTTTACTAAAGACAAATCATGG + Intergenic
1147354410 17:39882819-39882841 ATTAGACTAAAAATCAATAATGG - Intergenic
1148946863 17:51270298-51270320 AACATATTAAAAAACAAACATGG - Intronic
1150523441 17:65894171-65894193 AATATGCTAAAAATAACTCAAGG + Intronic
1150695835 17:67404368-67404390 ATTTTTCTAAAAAACAATCAAGG - Intronic
1150998776 17:70349947-70349969 CATATACAAAAATCAAATCAAGG + Intergenic
1151753176 17:76053626-76053648 AACATCCTAAAAAGCAATGAAGG + Intronic
1152044589 17:77927672-77927694 AAAATACTAAAAACTACCCAGGG + Intergenic
1152862942 17:82706196-82706218 AATAAAATAAAAACCAAACAAGG - Intergenic
1153230992 18:2935879-2935901 AGAATAGTAAAAACCACTCAGGG + Intronic
1155373968 18:25135865-25135887 TATATATTAAAAAGCAACCAAGG - Intronic
1155381693 18:25229619-25229641 AATATACCTGAAACAAATCAAGG + Intronic
1156848931 18:41702902-41702924 AATATACTCAAGAACTATCAGGG + Intergenic
1156873315 18:41974596-41974618 ACTATACTAAAAATTAATTAGGG - Intronic
1157011149 18:43650442-43650464 AATCTACTAAAAGGCCATCATGG - Intergenic
1157371984 18:47122248-47122270 ACTATACTAAAAATAAATAATGG + Intronic
1158255508 18:55543529-55543551 AATATAATAAAAAAGAATAATGG - Intronic
1159137316 18:64351662-64351684 AATAAACAAAAAACAAATAAGGG - Intergenic
1159240288 18:65733691-65733713 AAAATACTAAAAACAAATCGAGG + Intergenic
1159343793 18:67171358-67171380 AATTTACTAAAAGCCATTTAGGG - Intergenic
1159482270 18:69004689-69004711 CATAGATTAAAAAACAATCAAGG - Intronic
1159667102 18:71174897-71174919 ATTAAACTATAAATCAATCAAGG - Intergenic
1159991781 18:74917129-74917151 AATATATTAAAAACCCAGGAAGG - Intronic
1160252464 18:77215072-77215094 AATACACAAAAAGCCAATAATGG - Intergenic
1160934925 19:1590005-1590027 AATGTACTAAAAACCACTGGGGG + Intronic
1161361727 19:3853770-3853792 AATATACTAAAAACCAGGCTGGG + Intronic
1164791174 19:30983076-30983098 AATTGACTCAAAATCAATCATGG - Intergenic
1167279256 19:48557090-48557112 AATAAAATAAAAACCAAACAAGG + Intronic
1167844632 19:52151612-52151634 TTTTTACTAAAGACCAATCATGG - Intergenic
1167936264 19:52911178-52911200 AATATACTAAATGCCAAAAATGG - Intergenic
925095310 2:1193885-1193907 AATATACCAACTACAAATCAAGG - Intronic
925560929 2:5194389-5194411 AAGATACAAAAAACCAAGGAGGG + Intergenic
926064195 2:9824047-9824069 AATAAAATAAAAACCAACCCTGG + Intergenic
927223865 2:20742120-20742142 ATTTTACTAGAAACCAATAAAGG - Intronic
928065471 2:28160279-28160301 AATATACTAAAAACCAATCATGG - Intronic
929192879 2:39155973-39155995 AATTTACTAAAATTAAATCATGG - Intergenic
929197816 2:39204568-39204590 AATATTCTAATAACTAAGCAAGG - Exonic
929257993 2:39833923-39833945 ATGAAACTAAAAACCAATCATGG - Intergenic
929660095 2:43775336-43775358 ATTAAACTAAAAACTAACCATGG - Intronic
930386493 2:50701929-50701951 AATATACGAAAAAGCAACAATGG - Intronic
930998909 2:57758057-57758079 GATATACTTTAAGCCAATCATGG - Intergenic
931740341 2:65236989-65237011 AATATATTTTAAAACAATCATGG + Intronic
931972981 2:67610964-67610986 GATATAATAAAAACAAATCTAGG + Intergenic
932541292 2:72656153-72656175 AATATACTATAAAGCAATGATGG + Intronic
932648320 2:73529396-73529418 ATGACACTAAAAACCAATCCTGG - Intronic
935001531 2:99021952-99021974 AATATGCTAAAAATCATTGATGG - Intronic
935031925 2:99331003-99331025 AATATAATTAAAACCAACTAAGG - Intronic
935058465 2:99588164-99588186 AATAAAATTAAACCCAATCATGG - Intronic
935383203 2:102474649-102474671 AATAGATTAAATTCCAATCAAGG + Intronic
935472423 2:103476258-103476280 TTTTTACTAAAAACAAATCATGG + Intergenic
935873122 2:107473108-107473130 AATAAAATAAAAACCAGTCTTGG - Intergenic
936005117 2:108879612-108879634 AATATACTAAAAACTTAGCCTGG - Intronic
936406728 2:112211295-112211317 CATATAATAAAAATTAATCATGG + Intergenic
936659078 2:114522331-114522353 TATATACTAATAAGCAATCTAGG + Intronic
936741319 2:115512712-115512734 ATTATATTAAAAATCAATAATGG - Intronic
936885197 2:117301490-117301512 AAAAGACTAAAAAACAATGAAGG + Intergenic
937540972 2:122953023-122953045 AATATACTAAAACCTAGTGAAGG + Intergenic
937784690 2:125882408-125882430 AATCTACTAAAAAACAAACTGGG - Intergenic
937844190 2:126560232-126560254 AATATACAAAAAACAAAAAATGG + Intergenic
938154416 2:128920390-128920412 AATAAAATAAAAACCATTTAGGG - Intergenic
939693129 2:145290834-145290856 AAAATGCTCAAAACCAAACATGG + Intergenic
939781243 2:146450835-146450857 AATATACTACAAACACTTCATGG + Intergenic
939843591 2:147217725-147217747 TTTTTACTAAAAACAAATCATGG + Intergenic
940024750 2:149194176-149194198 TTTATGCTACAAACCAATCAGGG - Intronic
940325700 2:152422826-152422848 AATCTACTAAAAATCATTCAAGG - Intronic
940753138 2:157650243-157650265 AATATCCAAAAAAACAACCAAGG + Intergenic
941159944 2:162024494-162024516 AATATTTTAAAAACCAAAGAGGG - Intronic
941167644 2:162100157-162100179 AGAATACTAAAAATCATTCAAGG + Intergenic
941465845 2:165826005-165826027 CATATACTGGAAACCATTCATGG - Intergenic
941817199 2:169808224-169808246 AATATACTAAAAAACATTCAAGG + Intronic
942160148 2:173176558-173176580 AATATAATAAAAATCAATCAAGG + Intronic
942768227 2:179483154-179483176 AATATCACAAAAACAAATCATGG + Intronic
943055980 2:182980612-182980634 AAAAGGCTAAAAACCAATTAAGG + Intronic
943493760 2:188590779-188590801 AATACATTAAAAAACAAGCATGG + Intronic
943660004 2:190549357-190549379 AATATATGAAAAAGAAATCACGG - Intergenic
943887277 2:193235599-193235621 AATCTGCTAAAAAACAATCTTGG - Intergenic
944259684 2:197662989-197663011 AACATACTACAAAATAATCAAGG - Intronic
944266811 2:197736286-197736308 AATATTTTAAAAAAGAATCAAGG + Intronic
945080136 2:206080105-206080127 AATAGACTAAAAACTCCTCAAGG + Intronic
946205027 2:218098993-218099015 GAAATACAAAAAATCAATCAAGG - Intergenic
946309815 2:218877246-218877268 AATGTGCTAAAAAGCAATCAGGG - Intergenic
947133528 2:226954407-226954429 AAAATAATAAAAACAAAACAAGG - Intronic
947254006 2:228141448-228141470 AATGTGCTGAAAACCTATCAAGG - Intronic
948876235 2:240830952-240830974 AATAAAATAAAAAATAATCAAGG + Intergenic
1169887482 20:10416585-10416607 ATTATTATAAAAACCAATAAAGG + Intronic
1170017467 20:11797796-11797818 AATAAAATAAAAACCCATCATGG + Intergenic
1172415391 20:34762417-34762439 AATATACTAGTAAACAATAAAGG - Intronic
1172858324 20:38025703-38025725 AATATACTTCAAACAAATGAAGG + Intronic
1173711457 20:45159810-45159832 AATATATTAAAAACAAATAGAGG + Intergenic
1174028263 20:47597911-47597933 AAAAATCTAAAAACCAATCATGG - Intronic
1175519086 20:59588299-59588321 AATATAGTTAAAACAAATCTGGG + Intronic
1176291645 21:5048594-5048616 AATAAACAAAAAACAAATAAAGG - Intergenic
1176945326 21:14973281-14973303 AAAATACTAAGAACAAATAAAGG + Intronic
1177720457 21:24900119-24900141 ATTATTCTAAAAACAAATTATGG - Intergenic
1177720458 21:24900149-24900171 AGTATTCTAAAAACAAATTATGG - Intergenic
1178210282 21:30523224-30523246 AATAAACTAGAAATCAATAATGG - Intergenic
1178262663 21:31114549-31114571 TATATTCAACAAACCAATCAAGG + Intergenic
1179391726 21:40998735-40998757 AATTTACTAAAATCCACACAAGG - Intergenic
1179865610 21:44215047-44215069 AATAAACAAAAAACAAATAAAGG + Intergenic
1179884708 21:44308860-44308882 AATCCCCTAAAAACCATTCATGG - Intronic
1182187279 22:28418681-28418703 AATATACTAAAAAAATCTCAAGG - Intronic
1183123831 22:35755339-35755361 AATATGTGACAAACCAATCATGG + Intronic
1183389177 22:37534770-37534792 AATATACTAAAAACCTGGCCAGG + Intergenic
949916720 3:8970442-8970464 AAAATACAAAAAATTAATCAGGG + Intergenic
951282751 3:20772859-20772881 ATTCTATTAAAATCCAATCAAGG + Intergenic
954399015 3:50310020-50310042 ATTTTACTAAAGACAAATCATGG - Intronic
957361902 3:79171273-79171295 AATATACTAAAACAATATCAAGG - Intronic
957418373 3:79935367-79935389 ATAATACTAAAAATAAATCAAGG - Intergenic
957558697 3:81793784-81793806 AGTATACTAAAAACTAATAAAGG - Intergenic
960070478 3:113424487-113424509 AATATACTAATAATCATTAAAGG + Intronic
960228128 3:115191482-115191504 TTTTTACTAAAAACAAATCACGG - Intergenic
961190103 3:124953076-124953098 AATATGCTAAAAAAAAAACACGG + Intronic
961337616 3:126191686-126191708 AAAAGAATAAAAACCACTCAAGG - Intronic
963596276 3:147329861-147329883 ACTATAGTCAAAACCAATGAGGG + Intergenic
963611587 3:147475586-147475608 ATTATATTAAAAACCTATAATGG + Intronic
964662333 3:159134258-159134280 AATATACTAAAACACAATTATGG + Intronic
964949263 3:162267603-162267625 AATATACAAAAATCAACTCAAGG + Intergenic
965328332 3:167336058-167336080 AATAAAATGAAAACCAAACATGG - Intronic
966078093 3:175963458-175963480 AATTTATTAAAAAAGAATCACGG + Intergenic
966456458 3:180121830-180121852 AATAAACCAAAAATCAATAACGG - Intergenic
968933033 4:3593307-3593329 AATTTACTAAAGGCCAAGCATGG - Intergenic
969169903 4:5353235-5353257 CATATACAAAAAACAACTCAAGG + Intronic
969356539 4:6630578-6630600 TATTTAATAAAATCCAATCATGG - Intergenic
969419727 4:7085652-7085674 TTTTTACTAAAAACAAATCATGG + Intergenic
970015961 4:11512951-11512973 AATAAACAAAAGACCATTCATGG - Intergenic
970750761 4:19357492-19357514 AATGTACTCAAAGCAAATCATGG + Intergenic
971640390 4:29124484-29124506 AATATAATATAAACTAATAAAGG + Intergenic
972026138 4:34380710-34380732 AATATAATAAAAACAAAATAAGG + Intergenic
972186574 4:36534920-36534942 AATATGCAAGAAACCAATAATGG - Intergenic
973014406 4:45119337-45119359 AATATAGTAAGAATTAATCATGG - Intergenic
973016104 4:45139703-45139725 TATATATTAAATACAAATCATGG - Intergenic
973968221 4:56185255-56185277 AATATACTAAATGCCACTGAAGG - Intronic
974230148 4:59101850-59101872 AATATAATAAAAACAGATGAAGG + Intergenic
975547089 4:75570952-75570974 TATATACTAAAAAATATTCAGGG - Intergenic
975961963 4:79920185-79920207 TATCTACTAAAAACAAATCTAGG + Intronic
976796330 4:88937579-88937601 AATATTTTAAAAACCTATAAAGG - Intronic
977055763 4:92188421-92188443 TATATATTATAAAGCAATCAAGG - Intergenic
977368477 4:96102791-96102813 AATTTCCTAAAAACATATCATGG - Intergenic
977644452 4:99396336-99396358 AAGACACTAGAAACCAATCCTGG + Intergenic
978930761 4:114308456-114308478 TATATAATATAAACTAATCATGG + Intergenic
980560589 4:134468490-134468512 AATACATTATAACCCAATCATGG + Intergenic
980925313 4:139130662-139130684 AATATCCTACTAACCAGTCAAGG - Intronic
981736736 4:147961399-147961421 AAAGAACTACAAACCAATCAGGG - Intronic
981768881 4:148283662-148283684 CATATTCTAAAAACCAATAGAGG - Intronic
981830647 4:148996613-148996635 AATATATTAAAAACATATCATGG + Intergenic
982550577 4:156793645-156793667 AATTTTTTAAATACCAATCAGGG + Intronic
982591717 4:157322069-157322091 AATATTCTAAACAGCAGTCAGGG - Intronic
983021968 4:162688232-162688254 AACATTCTAAAAACCTATGAAGG + Intergenic
983301117 4:165927199-165927221 TATATACTAAAAGCAAATGAAGG + Intronic
983467132 4:168108465-168108487 AATATCCTAAAAACCTATAATGG - Intronic
984405013 4:179317703-179317725 ATTAAACTAGAAACCAATAACGG - Intergenic
984665039 4:182418021-182418043 ATTATACTAAAACTGAATCATGG + Intronic
985351598 4:189069192-189069214 AAAATACCAAACACAAATCAAGG - Intergenic
986232185 5:5876421-5876443 AATAGACAAATAACCAATAATGG - Intergenic
987293818 5:16532722-16532744 AAGATACTAATAAACAATGAAGG - Intronic
987900754 5:24008584-24008606 AAGAATTTAAAAACCAATCATGG - Intronic
987938057 5:24495433-24495455 AATATCTTAAAACCCATTCACGG - Intronic
988918984 5:35923242-35923264 CAGAGACTAAAAACCAGTCATGG + Intronic
989620753 5:43381790-43381812 GATAAACTTACAACCAATCATGG + Exonic
989637725 5:43554826-43554848 AATATACCAAAAAGAAATAAAGG + Intronic
989669456 5:43897921-43897943 AATATTCTAAAACAAAATCAAGG - Intergenic
989765648 5:45079900-45079922 AATCTATTAAAAACTAACCAAGG + Intergenic
989982384 5:50659841-50659863 AATATACTATAAAACACTCTTGG + Intergenic
990076950 5:51858116-51858138 AAAATACTAAAAGAAAATCAGGG + Intergenic
990733895 5:58839136-58839158 AATAGATTAAAAAAAAATCAAGG - Intronic
992146948 5:73860185-73860207 ACTATACTTAGAAACAATCAAGG - Intronic
992977813 5:82138686-82138708 AATATACTAAAAAGAATCCATGG - Intronic
993316596 5:86414886-86414908 AATATGCTAAAAACCACAGATGG - Intergenic
993468437 5:88276689-88276711 AATATACTAAAATACATTCCTGG - Intergenic
994874337 5:105396814-105396836 AATACACTATAAACATATCAAGG - Intergenic
994880888 5:105493905-105493927 AATATACAAATAACCAATGCTGG + Intergenic
995051039 5:107704075-107704097 AAAATACTATATACCAATTAGGG + Intergenic
995113245 5:108451251-108451273 TATATAATGAAAATCAATCAAGG - Intergenic
996567976 5:124901576-124901598 AATGTACTAAAAAGAAATGAAGG - Intergenic
997288870 5:132709119-132709141 ACTTTCCTAAAAACCAATCTTGG + Intronic
998332609 5:141342357-141342379 AACATACTAAAAGCCAATATAGG - Intronic
998573360 5:143285993-143286015 AATATATTAAATACCAATGTCGG + Intronic
998664957 5:144286715-144286737 AATATTCTTAAAATTAATCATGG - Intronic
1000665548 5:163991778-163991800 AAAATAATAATATCCAATCAAGG + Intergenic
1001065354 5:168531009-168531031 AAAATACTAAAAACCTATTGTGG - Intergenic
1001573506 5:172746603-172746625 AAAATACTTAAAACTACTCAAGG - Intergenic
1001906112 5:175474795-175474817 AATACACTAAAAATCTAGCAGGG + Intergenic
1003917084 6:10796965-10796987 AAAATACTACACACCAATAATGG + Intronic
1004211257 6:13647919-13647941 AACATACTAAAAAACATTGAAGG - Intronic
1004211340 6:13648840-13648862 AACATACTAAAAAACATTGAAGG - Intronic
1004349636 6:14879932-14879954 CTTATACTAAAAAACATTCATGG + Intergenic
1004847912 6:19666005-19666027 AATAGCCTTAAAACCATTCATGG - Intergenic
1005104137 6:22205034-22205056 ATATTATTAAAAACCAATCATGG + Intergenic
1005374579 6:25169273-25169295 AATATGCCAAAAACCAAACCTGG + Intergenic
1005571721 6:27152050-27152072 AAAATACAAAAAACCTAGCAGGG - Intergenic
1006494299 6:34410606-34410628 ATTATACTAAAGACCAAGAAGGG + Intronic
1007296635 6:40827437-40827459 AATATAATAAAAATCAATGTTGG - Intergenic
1007313398 6:40964401-40964423 AATATACTGTAAAGCATTCAAGG + Intergenic
1009805738 6:68600024-68600046 AATATATTAATAAGAAATCATGG - Intergenic
1010157614 6:72812944-72812966 AATAGATTATAAATCAATCAGGG - Intronic
1010737856 6:79462778-79462800 TATATACTAAAAACTAACCCAGG + Intergenic
1010975356 6:82306442-82306464 AATATACAAAAATCAAATCAAGG - Intergenic
1011090924 6:83598782-83598804 AATTTCTTAAAAACCAATGAAGG + Intronic
1011676083 6:89735527-89735549 AAGATTCTAAAAGCCAGTCATGG - Intronic
1012358171 6:98342327-98342349 AATCTACTAATAACCAATGAAGG - Intergenic
1014037285 6:116781586-116781608 AATATTCTAAAAAATAATAAAGG - Intergenic
1014132466 6:117850031-117850053 ATTTTACTAAAGACAAATCATGG + Intergenic
1014958043 6:127646236-127646258 AATATACTTCAAAACAATAAAGG + Intergenic
1015575275 6:134664814-134664836 AACAAACCAAAAACCAAACAAGG + Intergenic
1015612387 6:135038186-135038208 AATACTCTAAAAAACAATAAGGG + Intronic
1015838562 6:137450214-137450236 AATATATTAAAAACCAGGCTGGG - Intergenic
1015968417 6:138719027-138719049 AATATACAAAAAAAGAACCACGG - Intergenic
1016425011 6:143925833-143925855 AATCTACTAAGAATAAATCAGGG - Intronic
1017232330 6:152086233-152086255 AATATATTTTAAAACAATCAGGG - Intronic
1017351148 6:153443454-153443476 ATTTTACTAAAGACAAATCATGG + Intergenic
1017979834 6:159391226-159391248 AATGTAATAAAAAACAAACATGG + Intergenic
1018416222 6:163604274-163604296 AAAAAACAAAAAACAAATCAGGG - Intergenic
1018519988 6:164637789-164637811 AACATTCTAAAAAGCAATAAAGG + Intergenic
1019805554 7:3121525-3121547 ACTTTACTAAAAACAAAACAAGG + Intergenic
1019877363 7:3825900-3825922 ATATTACTAAAAACCAATCTGGG + Intronic
1020473738 7:8570147-8570169 AATAAATTAAGAACCATTCATGG - Intronic
1020917889 7:14219918-14219940 AATTAACTAAAAAATAATCAAGG - Intronic
1021235053 7:18132782-18132804 ACCTTACTAAAAACCAATCTAGG - Intronic
1021338647 7:19435581-19435603 AAAATATTAAAAACTAATGAGGG - Intergenic
1022047688 7:26635764-26635786 AATATAATAAACACTAATAAAGG + Intergenic
1023919993 7:44621362-44621384 AAGATATTAAAAGCCAAGCACGG - Intronic
1024207016 7:47172370-47172392 AATATGCTAAAAAACACTGAGGG + Intergenic
1024313708 7:47993763-47993785 AATACACTAAAAGCCACTGAAGG + Intronic
1024981399 7:55160386-55160408 AATATTCTAAATACAAATAAAGG - Intronic
1024994744 7:55264496-55264518 AATATAATAAAAACCATATATGG + Intergenic
1025634673 7:63312179-63312201 ATTTTACTAAAGACAAATCATGG - Intergenic
1025648023 7:63435991-63436013 ATTTTACTAAAGACAAATCATGG + Intergenic
1025741329 7:64198860-64198882 ATTTTACTAAAGACGAATCATGG + Intronic
1027525032 7:79258071-79258093 AATATGGACAAAACCAATCATGG - Intronic
1028184783 7:87769598-87769620 AATATACTTAAAAATAAACATGG - Intronic
1031825570 7:126561482-126561504 AGTAAAATAAAAACCAATCCAGG + Intronic
1032342200 7:131084761-131084783 AATAAACTCCAAACGAATCAGGG + Intergenic
1035867533 8:3101083-3101105 AATATTCTAAAAACTATTGAAGG + Intronic
1036015820 8:4783276-4783298 AATACACTCAAAACCACACAAGG + Intronic
1036169287 8:6467468-6467490 AAAATACTAAAAACAAAAAAAGG - Intronic
1036894232 8:12619204-12619226 AATAAACTCAAAATCAATTAAGG + Intergenic
1037051294 8:14377487-14377509 AAAATAATAAAAAAAAATCAAGG - Intronic
1037351227 8:17959716-17959738 AATAAAATAAAACACAATCAAGG - Intronic
1038261137 8:25995986-25996008 AATAGACTAAAAAATAAACAAGG + Intronic
1038555250 8:28507682-28507704 ATTATTCTAAAAACTAATAACGG - Intronic
1038809162 8:30822334-30822356 AATAAATTAAAAACCCAGCATGG - Intergenic
1039591197 8:38750608-38750630 AATATACAAAAATCAATTCAAGG + Intronic
1041154120 8:54966405-54966427 AATATAGTAAAATTCAATTATGG - Intergenic
1042006587 8:64186674-64186696 AATATACAAAAATCAACTCAAGG + Intergenic
1042387629 8:68196064-68196086 AATTTACTAAAAACAAAACCAGG - Intronic
1043671427 8:82889537-82889559 AAAATACTAACAAACAAGCATGG - Intergenic
1044378256 8:91501676-91501698 TTTTTACTAAAAACAAATCATGG + Intergenic
1045717350 8:105063798-105063820 AAAATACTAAAAAACATTCAAGG - Intronic
1045790090 8:105973303-105973325 AAGATACTGAAAAAGAATCATGG - Intergenic
1046850431 8:118966037-118966059 TATAAACTAAAAGCAAATCAGGG + Intergenic
1046885718 8:119364797-119364819 AATATACCAAAATAGAATCATGG + Intergenic
1047900269 8:129413503-129413525 ATTATCCTAAAAACCATTTAAGG + Intergenic
1048500701 8:134972250-134972272 AAAATACAAAAAACCCAACATGG + Intergenic
1050999384 9:12261379-12261401 AATCTACTCAAAACGAATCTAGG - Intergenic
1051136612 9:13929688-13929710 AATCAACTAAAAACCACTTAGGG + Intergenic
1051684914 9:19648137-19648159 AATAGACTAACAACCCATTAAGG + Intronic
1052058719 9:23933692-23933714 TATATATAAAAAACCCATCAAGG + Intergenic
1054457098 9:65438670-65438692 AATTTACTAAAGGCCAAGCATGG + Intergenic
1055012321 9:71580322-71580344 AAAATACTAAAAAGTCATCATGG + Intergenic
1056432510 9:86542084-86542106 AATATACGAAAAGAAAATCAAGG + Intergenic
1057340057 9:94192393-94192415 AATAAACAAAAAACCAACCTAGG - Intergenic
1057610764 9:96541535-96541557 AATATACTCAAAACCAATTCTGG + Intronic
1057616532 9:96595862-96595884 AATATATTAAAATCAGATCATGG + Intronic
1057626130 9:96678808-96678830 AATCAACTTAAAACAAATCAGGG + Intergenic
1057862417 9:98651848-98651870 AATATAAAAAAATCCAGTCAGGG - Intronic
1058210098 9:102157150-102157172 ATTAAACTAAAAATCAATAACGG - Intergenic
1058965001 9:110029039-110029061 AATATGCTGATAACCTATCAAGG + Intronic
1185958301 X:4517482-4517504 AATATCCTACACACCCATCATGG + Intergenic
1186490507 X:9968668-9968690 AATAAACAAAAAACCAAGAATGG + Intergenic
1186684367 X:11909637-11909659 AATATACTAAAAAGAAAAAAAGG - Intergenic
1186927275 X:14348187-14348209 AATATATTAAAAGGCTATCATGG - Intergenic
1187881353 X:23850485-23850507 AATATACTGAAACCCACCCAAGG + Intronic
1187906181 X:24068744-24068766 AATATACATAAAAGCAACCATGG - Intronic
1188063553 X:25630099-25630121 AGTTTACTTAAAACCAATTATGG - Intergenic
1188133804 X:26469860-26469882 TTTTTACTAAAAACAAATCATGG + Intergenic
1188324336 X:28781955-28781977 AATATACAAAATTACAATCATGG + Intronic
1188594634 X:31883759-31883781 AATATATTAAAAATAAATTATGG + Intronic
1188818161 X:34740898-34740920 AATATCCTACAAAACAAGCATGG + Intergenic
1190946926 X:55103973-55103995 AAAATAATAGAAACCAATGAAGG - Intronic
1191056528 X:56246993-56247015 AATACACTTAAAACAAATCCTGG - Intronic
1192024620 X:67436144-67436166 AATATTCTAGAAAACAATGAGGG - Intergenic
1192163137 X:68803601-68803623 AATAAACGAAAAACCTAACAAGG + Intergenic
1192241530 X:69333591-69333613 AATATAAAAAATACCAATGATGG - Intergenic
1193089487 X:77478890-77478912 ATAATACTCAAAACCAATGAGGG + Intergenic
1193203309 X:78718158-78718180 AATATAAAAAAAATCATTCAAGG + Intergenic
1193601725 X:83514774-83514796 AATATATTTGAAACCAATTAAGG + Intergenic
1193630609 X:83882294-83882316 AATATATTAAAAACAAATGTAGG - Intronic
1194004154 X:88469792-88469814 ATTTTACTAAAAACAAATCATGG - Intergenic
1194362269 X:92966858-92966880 AATATATAAGAAACCAACCAAGG + Intergenic
1194369340 X:93051884-93051906 AATTAACTGAAAACAAATCATGG - Intergenic
1194872148 X:99145553-99145575 AATGTAATAAAAATTAATCATGG + Intergenic
1195524137 X:105866396-105866418 AATAAACTAAAAAATAATCAAGG + Intronic
1195619047 X:106934991-106935013 AGTATAATAAAAAAAAATCAAGG + Intronic
1195634064 X:107093082-107093104 AATACACTAAAAAATAATTAAGG + Intronic
1195724549 X:107900843-107900865 CATATAAAAGAAACCAATCAAGG - Intronic
1196441219 X:115721750-115721772 ATTCTCCCAAAAACCAATCAAGG + Intergenic
1196444748 X:115839738-115839760 ATTCTCCCAAAAACCAATCAAGG + Intergenic
1196478353 X:116114220-116114242 TATAAACTAAAAAACAATTATGG + Intergenic
1197258489 X:124290390-124290412 AAACTACTAAAAATCATTCATGG - Intronic
1197383714 X:125778212-125778234 AATATAATATAACACAATCAGGG + Intergenic
1197842068 X:130759200-130759222 AATATACTCAAAATGGATCATGG - Intronic
1200670519 Y:6083081-6083103 AATATATAAGAAACCAACCAAGG + Intergenic
1200677533 Y:6168110-6168132 AATTAACTGAAAACAAATCATGG - Intergenic
1200949100 Y:8876016-8876038 AATATAGTAAGAACAAATAAAGG + Intergenic
1201552264 Y:15229976-15229998 AATATATTATTAAGCAATCAAGG + Intergenic
1201851195 Y:18482688-18482710 GTTATATTATAAACCAATCATGG - Intergenic
1201882124 Y:18837690-18837712 GTTATATTATAAACCAATCATGG + Intergenic
1201927703 Y:19307407-19307429 AAACTACTAGAAACCAATCCTGG - Intergenic