ID: 928065471

View in Genome Browser
Species Human (GRCh38)
Location 2:28160279-28160301
Sequence AATATACTAAAAACCAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065471_928065477 15 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065471_928065473 -10 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065471_928065474 1 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065471 Original CRISPR AATATACTAAAAACCAATCA TGG (reversed) Intronic