ID: 928065472

View in Genome Browser
Species Human (GRCh38)
Location 2:28160291-28160313
Sequence TTTAGTATATTCTTTTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 504}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065466_928065472 12 Left 928065466 2:28160256-28160278 CCAGGACTAGCCACTGCGCCTGG 0: 1
1: 0
2: 1
3: 40
4: 349
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065468_928065472 2 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065470_928065472 -6 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065464_928065472 28 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065465_928065472 21 Left 928065465 2:28160247-28160269 CCTGGGATTCCAGGACTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065472 Original CRISPR TTTAGTATATTCTTTTTAGC TGG Intronic