ID: 928065472

View in Genome Browser
Species Human (GRCh38)
Location 2:28160291-28160313
Sequence TTTAGTATATTCTTTTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 504}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065468_928065472 2 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065466_928065472 12 Left 928065466 2:28160256-28160278 CCAGGACTAGCCACTGCGCCTGG 0: 1
1: 0
2: 1
3: 40
4: 349
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065465_928065472 21 Left 928065465 2:28160247-28160269 CCTGGGATTCCAGGACTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065464_928065472 28 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504
928065470_928065472 -6 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG 0: 1
1: 0
2: 3
3: 43
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065472 Original CRISPR TTTAGTATATTCTTTTTAGC TGG Intronic
901116095 1:6845669-6845691 TTTAGTAATTGCTTCTTAGCAGG + Intronic
901298328 1:8178350-8178372 TTGTGTATATTCTCTTTATCTGG + Intergenic
901463091 1:9403357-9403379 TTTTGTATTTTTTTTTTAGACGG + Intergenic
901928336 1:12581227-12581249 TCTTGTATATTACTTTTAGCAGG + Intronic
903208282 1:21799481-21799503 TTTAATATATTTTTTTGAGACGG + Intergenic
904723658 1:32530330-32530352 TTAAGTATATTCTTATTAAGGGG + Intronic
906853389 1:49278275-49278297 TTTAGTATTTCCTTTTAACCTGG - Intronic
907174429 1:52505261-52505283 TTTTGTAGATTTTTTTTAACAGG + Intronic
907722880 1:56989187-56989209 TTGAATATATTCTAATTAGCAGG - Intergenic
907977606 1:59447418-59447440 TTCAGTATCTGCTTTTTTGCAGG - Intronic
908173515 1:61531118-61531140 TTACGTTTGTTCTTTTTAGCAGG + Intergenic
909058356 1:70849195-70849217 TTAAGTATATTTCTATTAGCTGG - Intergenic
909395995 1:75171440-75171462 TTTAGTATATTTTCTCTACCTGG + Intergenic
909437105 1:75655050-75655072 TTTAGTTTAATCTTTTAATCTGG - Intergenic
909578571 1:77205047-77205069 TTTTGTATATTATGTTTAGTAGG - Intronic
909760775 1:79283750-79283772 TTTTGTATTTTTTTTTTAGTAGG - Intergenic
910271602 1:85401296-85401318 ATTGGTATCTTCTTTTTACCTGG + Intronic
910925662 1:92395910-92395932 TTTATTATAGTCATTTTAGTGGG - Exonic
911137841 1:94460994-94461016 TTTAGCATATACTTATTTGCTGG + Intronic
911353959 1:96793371-96793393 TTTATTTTATTTTTTTTAGTTGG + Intronic
911548776 1:99254438-99254460 TTTATTTTATTATTTTTAGAGGG + Intergenic
913154526 1:116082310-116082332 TTTATTTTATTTTTTTTAGATGG + Intergenic
913364962 1:118027312-118027334 TTTAGTTTCTGCTTTTTTGCGGG + Intronic
914372312 1:147038375-147038397 TTTAGTATATTCTCTTTACACGG - Intergenic
914889337 1:151608936-151608958 TTTATTATTATCTTTTTAGATGG + Intergenic
915889984 1:159764197-159764219 TTTATTTTTTTCTTTTTAGAAGG + Intergenic
916371025 1:164094288-164094310 TTTTGTAAATACTTTTTATCAGG - Intergenic
916409840 1:164535588-164535610 TTTGGTGTAGTCTTTTTGGCAGG + Intergenic
916454285 1:164954457-164954479 ATTAGTATTTTCTTTTTTCCAGG - Intergenic
916910297 1:169339283-169339305 TCAAGTATATTCTTTTAAGATGG - Intronic
917825435 1:178815249-178815271 TTTTGTATTTTTTTTTTAGTAGG + Intronic
918545935 1:185683876-185683898 TTTAAAATAGTCTATTTAGCTGG - Intergenic
918898375 1:190379109-190379131 TTTTGTATATTGTTTTCAGCAGG - Intronic
919023856 1:192143665-192143687 TTTATTTTATTCTTTTGAGACGG + Intergenic
919247508 1:195007265-195007287 TTTCTTATATTTTTTTTGGCCGG + Intergenic
919590949 1:199501446-199501468 TTTTGTAGATTCTCTTTATCAGG - Intergenic
919679334 1:200418959-200418981 TATAATAAATTCATTTTAGCTGG - Intergenic
919954361 1:202398070-202398092 TATAGAAAATACTTTTTAGCTGG - Intronic
920079064 1:203359128-203359150 TTTAGGCTATTCTTCTTGGCTGG + Intergenic
920272642 1:204777767-204777789 TTTAGTTTATTATTTTTAGCGGG + Intergenic
920362067 1:205425875-205425897 ATTAGTAAATTCTTTTTATATGG + Intronic
921143075 1:212324429-212324451 TTTTGTGTCTTCTTTTTTGCTGG + Intronic
921786317 1:219234197-219234219 ATTAGTATATTCTTTGTTCCAGG - Intergenic
921832205 1:219740786-219740808 TTTTGTATTTTCTTTTTATGAGG - Intronic
923820523 1:237435097-237435119 TTTACTATATTATTTTTATCTGG + Intronic
923879184 1:238084763-238084785 TTTTGTTTTTTCTTTTGAGCCGG + Intergenic
924435003 1:244031706-244031728 TTTAGGGTATTTTTTTTAACAGG - Intergenic
924481632 1:244440332-244440354 TTTTGAAGATTTTTTTTAGCAGG - Intronic
924487672 1:244502497-244502519 CTGTGTATATTCTTTTTAACTGG + Intronic
1062897988 10:1119397-1119419 TTTAGAATCTTATTTTTGGCCGG + Intronic
1063243913 10:4198991-4199013 TTTATTATTTTTTTTTTAGGCGG + Intergenic
1063303756 10:4877411-4877433 TTTTGTTTATTTTTTTTAGGTGG - Intergenic
1063627552 10:7704669-7704691 TTTAGTATATTTCTATTTGCTGG - Intronic
1064339924 10:14476748-14476770 TTTGGCAAAGTCTTTTTAGCTGG - Intergenic
1064491602 10:15863293-15863315 TTTAGCATATTGTTTTTCTCAGG + Intergenic
1065151825 10:22830388-22830410 TTTTTTATATTCTTTTGAGACGG - Intergenic
1065222013 10:23505672-23505694 TTTAGTATACCCTTTGTAGAGGG + Intergenic
1065722604 10:28641351-28641373 TTTAATTTATTTTTTTGAGCTGG + Intergenic
1065909897 10:30293552-30293574 TTTTATTTTTTCTTTTTAGCAGG + Intergenic
1065928978 10:30462318-30462340 ATTATTATTTTATTTTTAGCAGG - Intergenic
1065981925 10:30906704-30906726 TTTTGTAGATTCTCTTTATCAGG + Intronic
1066259307 10:33713561-33713583 TTCAGTTTATTTTTTTTAACAGG - Intergenic
1067967137 10:50925439-50925461 TTTATTATTTTCTTTTAGGCAGG + Intergenic
1069538750 10:69277269-69277291 TTTAAAATTTTCTTTTTGGCTGG + Intronic
1071016957 10:81008788-81008810 TTTTGTTTGTTCATTTTAGCAGG - Intergenic
1071265913 10:83964814-83964836 TTTACTCTATTCTTTTTGCCTGG - Intergenic
1071325461 10:84511822-84511844 TTTAGTATCTTCCGTTTTGCGGG + Intronic
1071936624 10:90538924-90538946 TTTATTATATTATTTTTAAAAGG + Intergenic
1072061863 10:91821040-91821062 TTTATTTTATTTTTTTTAGACGG + Intronic
1072280894 10:93864246-93864268 TTATGTGTATTCTTTTTAGGAGG + Intergenic
1072331206 10:94353720-94353742 TTTGGGAAATTCTTTTTTGCTGG + Intronic
1073721194 10:106174311-106174333 TTTATTTTATTCTATTTTGCCGG + Intergenic
1074279878 10:112040928-112040950 TTTAGTTTATCCTTGTTGGCTGG - Intergenic
1074397776 10:113112876-113112898 TTTATTTTATTCTTTTTAAAAGG - Intronic
1074757144 10:116632411-116632433 TTTAGTCTATTTTTCTGAGCTGG + Intronic
1074840185 10:117343783-117343805 TTTAGTATATTCATTTAAAATGG - Intronic
1074851558 10:117443351-117443373 TTTAGTGTTTTCTCTTTAGTTGG + Intergenic
1075836035 10:125453634-125453656 TTTGGATTATTATTTTTAGCTGG - Intergenic
1077931702 11:6739578-6739600 TTTAGTATTTTTTTTTCAGAAGG + Intergenic
1078232287 11:9454451-9454473 TTTTGTATTTTTTTTTTAGACGG + Intergenic
1079583839 11:22100236-22100258 TTTAGTATATTTTGTAAAGCAGG - Intergenic
1079600379 11:22304882-22304904 TGTAGTATATTCTTTTTACTTGG + Intergenic
1079882793 11:25946727-25946749 TTAAGTATATTTTTGGTAGCAGG - Intergenic
1080593708 11:33748570-33748592 TTTATTTTATTTTTTTTAACTGG - Intronic
1081096951 11:38948216-38948238 TTTAGTATTTTTTGTTTAGTTGG + Intergenic
1081115558 11:39194415-39194437 TTTTGTATTTTTTTTTTAGTAGG - Intergenic
1081236850 11:40656840-40656862 TTTAGGAGATTCTGTTTAACTGG - Intronic
1081467425 11:43334499-43334521 ATTAGTATACTCATTTTAACTGG + Intronic
1081834263 11:46141260-46141282 TTAAATATATTCTATTTGGCTGG + Intergenic
1082742652 11:56927672-56927694 TTGACTAAATTGTTTTTAGCAGG - Intergenic
1083214781 11:61211574-61211596 TTTAATATATTCTTTTTCTCTGG - Intronic
1083217665 11:61230403-61230425 TTTAATATATTCTTTTTCTCTGG - Intronic
1083220661 11:61250153-61250175 TTTAATATATTCTTTTTCTCTGG - Intronic
1084292486 11:68183360-68183382 ATTAGTTTTTTGTTTTTAGCCGG + Intronic
1084896426 11:72273872-72273894 TTTATTATAGTCATTTTGGCGGG + Intergenic
1085194003 11:74655715-74655737 TTTTGTAGATTCCATTTAGCAGG - Intronic
1086555236 11:88102579-88102601 GTGAATATATACTTTTTAGCTGG - Intergenic
1087376893 11:97353840-97353862 TTAATTGTATTCCTTTTAGCTGG - Intergenic
1088631906 11:111781649-111781671 TTTATTATTTTTTTTTTAGATGG + Intergenic
1089965188 11:122649907-122649929 TTTATTATATTTTTTTGAGACGG + Intergenic
1091198468 11:133751827-133751849 TTTAATAAATACTTTTTAGTGGG - Intergenic
1092422946 12:8347560-8347582 TTTTGTATATTCTTTTGATTTGG - Intergenic
1093280017 12:17182078-17182100 TTTAGTATATTCTATATATCAGG - Intergenic
1093410590 12:18860765-18860787 TTTAATTTATGCTTTTAAGCAGG - Intergenic
1093657556 12:21713680-21713702 TTTAGTATATTCTTCTCAATTGG + Intronic
1093777524 12:23093846-23093868 TTTATTGTAGTCTTTTTAGGGGG + Intergenic
1093839885 12:23884488-23884510 TTTTTTAAAATCTTTTTAGCTGG - Intronic
1094003582 12:25723378-25723400 TTTAGTTGATTCTTGTTGGCTGG - Intergenic
1094097420 12:26722908-26722930 TTTAGTATATTCTGTTTTTGTGG - Intronic
1094456487 12:30640420-30640442 TTTATTATTTTCTTTTTAGTAGG + Intronic
1095341118 12:41089426-41089448 ATTATTATTTTTTTTTTAGCGGG - Intergenic
1095883379 12:47163194-47163216 TTTAGAATTTTCTTTTCAGATGG + Intronic
1096438087 12:51612470-51612492 TTTAGTACATTCATTTTATCAGG + Intronic
1096874882 12:54620418-54620440 TTTAGTTCATTCTTTTGAGGTGG + Intergenic
1097066774 12:56326482-56326504 TTCAGTATTTTCTTTTTCTCTGG - Intronic
1097629305 12:62040317-62040339 TTCAATATATTCTTTTTTGGGGG - Intronic
1097874323 12:64629421-64629443 TTAAGTATAGTCCTTCTAGCTGG - Intronic
1098473442 12:70871840-70871862 TTGAGTATATATTTTTGAGCAGG + Intronic
1099017765 12:77365212-77365234 TTTAGTAAATTCTTTGGTGCTGG + Intergenic
1099722807 12:86385019-86385041 TTCAAAATATTCTTTTTAGTAGG - Intronic
1100491163 12:95079561-95079583 TTTAGTGTATTCCTTTTTGGAGG - Exonic
1101285394 12:103306719-103306741 TTTAATATATCTTTTTTGGCAGG - Intronic
1103666188 12:122567829-122567851 TTTACTTTATTTTTTTGAGCTGG - Intronic
1104290208 12:127459793-127459815 TGTTTTATTTTCTTTTTAGCTGG - Intergenic
1104646824 12:130503389-130503411 TTTTGTTTTTTCTTTTTAGATGG - Intronic
1105830175 13:24157301-24157323 TTTAATATATTTTTTTGAGATGG + Intronic
1105907356 13:24826147-24826169 TTTAATATATTCTTCTTTCCTGG + Intronic
1105982805 13:25536114-25536136 TTTATTTTATTCTTTTTAGACGG + Intronic
1106202938 13:27557922-27557944 TTGAGTATATTCATTTAAGCAGG + Intronic
1107203179 13:37747426-37747448 TTTAGTTTATTTATTTTTGCTGG + Intronic
1107897755 13:44983169-44983191 TTTATTTTATTTTTTTTGGCGGG + Intronic
1109877092 13:68419229-68419251 TTTATAACTTTCTTTTTAGCAGG + Intergenic
1109956176 13:69569500-69569522 TTTACTATATACTTTGTAGGGGG - Intergenic
1110520868 13:76474744-76474766 TTTACTATATTATTTTTATGTGG + Intergenic
1110892863 13:80712097-80712119 GTTAGGATATTGTTTTTACCCGG + Intergenic
1111486910 13:88914566-88914588 TTTATTTTTTTCTTTTTTGCAGG - Intergenic
1111945282 13:94658584-94658606 TTTTGTATTTTTTTTTTAGTGGG + Intergenic
1112833085 13:103477685-103477707 TTTAGTGTGTTCTTTTTGGGTGG + Intergenic
1112902335 13:104373471-104373493 TTTAGTATGTTCATATTACCAGG + Intergenic
1113230459 13:108208157-108208179 TTTAGAATATACTGTTTAGAAGG + Exonic
1113935667 13:113994018-113994040 TTTAGTAAATACTTTTTAAAAGG + Intronic
1114975266 14:28088738-28088760 ATTTGGATATTCTTTTCAGCAGG + Intergenic
1116001746 14:39250269-39250291 TTTCGTACATTTTATTTAGCTGG + Intronic
1116156832 14:41216213-41216235 TTAAAAATATTATTTTTAGCGGG + Intergenic
1116425468 14:44784962-44784984 TTTAGCATATACATTTTAGGGGG - Intergenic
1116937326 14:50754965-50754987 TTTAGACTTTTCTTTTTAACTGG - Intronic
1116973137 14:51088838-51088860 TTTAGAATATTGTGTTTAGAAGG - Intronic
1117287326 14:54299049-54299071 TTGTGTTGATTCTTTTTAGCTGG + Intergenic
1117311709 14:54532145-54532167 TTGAGTTTATTTTTTTTAGCAGG + Intronic
1118023783 14:61747252-61747274 TTTAGTATGTTCTTTAATGCTGG + Exonic
1118411348 14:65481708-65481730 TCTAGTATATACTTTTGGGCAGG + Intronic
1118528674 14:66675847-66675869 GATATTTTATTCTTTTTAGCAGG + Intronic
1119111079 14:71974788-71974810 TTTAGTATTTTCTTTAGTGCAGG + Intronic
1119412680 14:74444069-74444091 TTTATTTTATTTTTTTTAGATGG + Intergenic
1119557877 14:75567338-75567360 TTTTTTATATTTTTTTTAGTAGG - Intergenic
1121815726 14:96926576-96926598 TTTATTTTATTTTTTTTAGATGG - Intronic
1122469645 14:101957479-101957501 TTTTGTATTTTTTTTTTAGACGG - Intergenic
1122746712 14:103901517-103901539 TTTATTATTTTTTTTTTAGATGG + Intergenic
1123626189 15:22228319-22228341 TCTAGTATTTTCTGTTAAGCTGG - Intergenic
1125254459 15:37746907-37746929 TCTACTATATTCTTTTTAAGGGG - Intergenic
1125571512 15:40722687-40722709 TTTACTATACTGTTTTTAGAAGG + Intronic
1125802926 15:42466418-42466440 TTTAGTAAATTCTTTATAATGGG - Intronic
1126556122 15:49989470-49989492 TTTTTTATATTCCTTTTGGCAGG - Intronic
1127084344 15:55411155-55411177 TTTATTATTTTCTTTTTTGCAGG - Intronic
1127261073 15:57326638-57326660 TTTAGTGAATTCTTTTTACCTGG + Intergenic
1127447298 15:59077262-59077284 TTCAGTATATTATTTTTAAAGGG - Intronic
1129580235 15:76801297-76801319 TTTAGTTTTTCCTTTTTAGTTGG + Intronic
1130291106 15:82601960-82601982 TTTTCTATATTCTTTTTTGCAGG - Intronic
1130763465 15:86845547-86845569 TTTACTTTATTCTTTTGATCTGG + Intronic
1131659026 15:94494000-94494022 TTTAGAAGATTCTTATTATCAGG + Intergenic
1133325545 16:4940120-4940142 TTTAATTTATTTTTTTTAGAAGG + Intronic
1133537946 16:6720087-6720109 TTTATTTTATTCTTTTCAGATGG - Intronic
1133653990 16:7841885-7841907 TTTAGTATATGATTTTGAGCAGG + Intergenic
1134752856 16:16639946-16639968 TTTATTTTATTCTTTTGAGATGG + Intergenic
1134993202 16:18719130-18719152 TTTATTTTATTCTTTTGAGATGG - Intergenic
1136131480 16:28224678-28224700 TCTAGTTTTTTCTTTTTAGCAGG + Intergenic
1136407968 16:30059981-30060003 TTTATTTTATTCTTTTGAGATGG + Intronic
1137633076 16:49961390-49961412 TTTAGTAAATTACTCTTAGCTGG - Intergenic
1138976027 16:62208953-62208975 TTGAGTATATTCTCTTTAATGGG + Intergenic
1139891633 16:70256816-70256838 TTAAGAATGTTCTTTTCAGCCGG + Intronic
1140101019 16:71916770-71916792 TTCTGTATTTTCTTTTTAACAGG - Intronic
1141597216 16:85104709-85104731 TTTATTTTATTTTTTTTAGATGG - Intronic
1144238762 17:13288652-13288674 TTTAGTCTCTTCCTTTTAGGAGG - Intergenic
1144319881 17:14104491-14104513 TTTACTATACTTTTTTTAGAGGG + Intronic
1144333604 17:14248613-14248635 ATTATTATATTCTTTTTAATGGG + Intergenic
1144469252 17:15522940-15522962 TTTGGTTTGTTCTTTTTAGAGGG - Intronic
1144542919 17:16162512-16162534 TTCAGTATATTCTTTTCTTCGGG - Intronic
1144927102 17:18820727-18820749 TTTGGTTTGTTCTTTTTAGAGGG + Intergenic
1149109957 17:53017109-53017131 TTTTTTTTTTTCTTTTTAGCAGG - Intergenic
1149277302 17:55056189-55056211 TTTAATATATTTTATTTAGTTGG + Intronic
1149534633 17:57423298-57423320 TTAAGTATATGCTTTTAACCTGG + Intronic
1149617664 17:58014928-58014950 TTTTGTTTATTTTTTTTAGATGG - Intergenic
1149626978 17:58086487-58086509 TTGATTATTTTCATTTTAGCAGG - Intronic
1150915069 17:69428555-69428577 TTCAGTATATTAATTTTAGGAGG + Intronic
1151084011 17:71360432-71360454 TTTGGCATTTTCTTTTTTGCGGG - Intergenic
1152726037 17:81946641-81946663 TTTTGTATTTTCTTTTGAGACGG - Intronic
1152877351 17:82794466-82794488 TCTAGTGTATGCTTTTCAGCAGG + Intronic
1153592901 18:6692972-6692994 TTTAGTATATTTTTATTTTCAGG + Intergenic
1153888269 18:9487422-9487444 TTTAGCGTATTTTTTTTAACAGG + Intronic
1154255963 18:12781052-12781074 TTTATTTTATTTTTTTTAGATGG + Intergenic
1154283201 18:13026942-13026964 TTTAATTTTTTCTTGTTAGCTGG + Intronic
1155021373 18:21900198-21900220 TTAAATATATTATTTTTGGCTGG + Intergenic
1155679039 18:28467005-28467027 TTTAATATATGCTTTTTTGGGGG + Intergenic
1155726972 18:29098948-29098970 CTTAGAATGTTCTTTTTATCAGG + Intergenic
1155952462 18:31928149-31928171 TTTATTTTATTTTTTTTAGTCGG - Intronic
1156053063 18:32961868-32961890 TGTAATATATGCTTTTTAGTGGG + Intronic
1156109437 18:33706656-33706678 TTTAGTGTATTTTTTTTATTGGG + Intronic
1156566612 18:38198420-38198442 TTTGGAATATTCATTTTAGGGGG + Intergenic
1157848140 18:51023093-51023115 TTTAATATAATATTTTAAGCTGG + Intronic
1157908337 18:51590435-51590457 TTTAATAAATTTTTTTTACCTGG + Intergenic
1158467106 18:57700401-57700423 TTAAGTTTATTATTTATAGCAGG + Intronic
1158777943 18:60609482-60609504 TTTATTTTATTGTTTATAGCAGG + Intergenic
1159166947 18:64714509-64714531 TTTTTTATTTTCTGTTTAGCTGG + Intergenic
1159378862 18:67630583-67630605 TTATTTATTTTCTTTTTAGCGGG + Intergenic
1159649495 18:70960784-70960806 TTTATTGTACTCTTTTTAACAGG - Intergenic
1160089685 18:75814856-75814878 TTTAGAATTTTCTTTTTAACTGG - Intergenic
1160606197 18:80051262-80051284 TTTAGTACTTGCTTTTTTGCAGG + Intronic
1163997388 19:21063912-21063934 TTTTGTATAATTTTTTTAGTGGG + Intergenic
1164135527 19:22412097-22412119 TATACTATGTTCTTTTTAGATGG - Intronic
1164175622 19:22771549-22771571 TTAAGAAAATGCTTTTTAGCTGG - Intronic
1165632917 19:37316976-37316998 TTTATTTTATTCTTTTCAGACGG + Intronic
1167154025 19:47727281-47727303 TTTAGTAGAGTATTTTTAGTTGG + Intronic
925061586 2:895437-895459 TTTCATATATTCTTATGAGCAGG - Intergenic
925093660 2:1176247-1176269 TTTAATATGTTCGTTTTAGAAGG + Intronic
925572769 2:5329680-5329702 TTAAGTACATTCTTTATAGCTGG + Intergenic
925655016 2:6137223-6137245 TGTAATATATACTTTTTAGATGG + Intergenic
926148632 2:10412166-10412188 TTAAGTTTCTTCTTTTTAGAAGG + Intronic
926474011 2:13299502-13299524 TTCAGCATATACTTTATAGCAGG - Intergenic
926930571 2:18035438-18035460 TTTATTATAATCATTTTAGTGGG + Intronic
927012850 2:18923968-18923990 TTTAGTATATTCTGTGTGACAGG - Intergenic
927773736 2:25885885-25885907 TTTAAAATATTATTTTTGGCTGG - Intergenic
928065472 2:28160291-28160313 TTTAGTATATTCTTTTTAGCTGG + Intronic
928539411 2:32270179-32270201 TTTATTTTATTCTTTTGAGACGG - Intergenic
928701756 2:33905323-33905345 TTTAGTATTTACTCTTTACCAGG - Intergenic
928753435 2:34496381-34496403 TTCAGTATATTAATTTTGGCAGG - Intergenic
929222124 2:39475806-39475828 TCTAGTATTTTGTTTTTACCTGG + Intergenic
930981703 2:57533766-57533788 TTTATTTTAGTCATTTTAGCAGG - Intergenic
931252186 2:60542710-60542732 TTTAGAGGATTCTTTTTACCTGG - Intronic
932047661 2:68365668-68365690 TTTAGAATATCCTTTTTAAGAGG + Intronic
932640472 2:73440833-73440855 TTTATAATCTTCTGTTTAGCAGG + Intronic
933359909 2:81268467-81268489 TTTACTTTATTCTTTTTTGTAGG - Intergenic
933646282 2:84815197-84815219 TAAACTAAATTCTTTTTAGCTGG - Intronic
935087250 2:99859931-99859953 TTTAGGTTATCCTTTTTTGCGGG - Intronic
935150767 2:100433121-100433143 TTTTGTATTTTTTTTTTAGTAGG - Intergenic
935326482 2:101942326-101942348 TTTTGTTTATTTTTTTTAGATGG + Intergenic
935343174 2:102076715-102076737 TTTAAGATTTTCTCTTTAGCAGG + Intronic
935479299 2:103564419-103564441 TTTTTTATTTTCTTTTTAGATGG - Intergenic
935799502 2:106679421-106679443 TTTATTATTCTCTTTTTATCAGG + Intergenic
935942043 2:108249284-108249306 TTTAATATATTATTTTTACTGGG - Intronic
936660664 2:114539705-114539727 TTGAGTATATTCTTTGTGCCAGG - Intronic
938828474 2:135030664-135030686 TTTTGGATAGTCTTTTTTGCAGG + Intronic
940536583 2:154953283-154953305 TTTAGTATCTCCTTTCTATCTGG + Intergenic
941008827 2:160275378-160275400 TTTATTTTTTTCTTTTTAGTGGG + Intronic
941719161 2:168794893-168794915 CTTAGTAAATACTTTTTAACAGG + Intronic
942030257 2:171952285-171952307 TTTAGAAGACTCTTTTAAGCTGG + Intronic
942230403 2:173856130-173856152 TTTTGTTTTTTCTTTTTTGCTGG - Intergenic
942894149 2:181030771-181030793 CTTAGTCTGTTCTTTTTAGTAGG + Intronic
943266697 2:185740426-185740448 TTTAGTACATTCTTGTTGACTGG + Intronic
943839324 2:192558643-192558665 TGTAGGTTCTTCTTTTTAGCTGG + Intergenic
944538268 2:200732465-200732487 TTCATCATATTCTTTTTTGCAGG + Intergenic
945032415 2:205678347-205678369 TCTAGTATATTCTATTTGGTGGG - Intergenic
945190779 2:207185247-207185269 TTTAGTATAATATTTTTACTGGG + Intergenic
945883330 2:215349449-215349471 GTTAGCATATGCTTTTTAGAGGG + Intronic
947358988 2:229327691-229327713 TTTCATATATTCCTTTTATCAGG - Intergenic
947781808 2:232773164-232773186 TTTAGTGTATTCTTTTTTCTTGG + Intronic
948079773 2:235196269-235196291 TTTTTTAAATTCTTTTTATCAGG - Intergenic
948156301 2:235785604-235785626 TTTTGTATAGTTTCTTTAGCTGG + Intronic
1170485327 20:16810043-16810065 TTGAGTATATTCTGTTTAATAGG + Intergenic
1170561843 20:17565256-17565278 ATTGGTATATCCTTTTTAGAAGG + Intronic
1171542058 20:25968210-25968232 TTTATTTTATTTTTTTTAGATGG + Intergenic
1171852846 20:30320703-30320725 TTTATTTTATTTTTTTGAGCCGG + Intergenic
1173334030 20:42098647-42098669 TTTTGTATAATCTATTTGGCAGG - Intronic
1173799308 20:45885004-45885026 TTTATTTTATTTTTTTTAGATGG - Exonic
1174636220 20:52001961-52001983 TTTAAAATATACTTTTTAGCTGG - Intergenic
1174910471 20:54602677-54602699 TTTAATGTATTTTTTTTAGATGG + Intronic
1175104016 20:56601172-56601194 TTTAGAATTTTCATTTTATCAGG - Intergenic
1177017346 21:15808753-15808775 TCTAGTATTTTTTTTTTAGTAGG + Intronic
1177342196 21:19817879-19817901 TTTAGCATATTCTTTTTAGTAGG + Intergenic
1177381003 21:20344210-20344232 TTTATTATTTTCTTTTAAGATGG - Intergenic
1177612207 21:23466265-23466287 TTTATTTTATTTTTTTTAGATGG - Intergenic
1178055779 21:28796979-28797001 TTTAGTTTATTCTGTTTTGTTGG + Intergenic
1178056212 21:28801277-28801299 TTTATTTTATTCTTTCTAGTTGG - Intergenic
1178057621 21:28817037-28817059 TTTAGCATTTTCTTTTTCACTGG - Intergenic
1178096204 21:29218475-29218497 TTTGGAATATTCTCTTTGGCAGG - Intronic
1178246651 21:30959470-30959492 TTTAGAATAGTATTTTTGGCAGG - Intergenic
1178905884 21:36635646-36635668 TTTAATATATTGTTTAAAGCAGG - Intergenic
1179103295 21:38376079-38376101 GTTAGTATTTTCTTTTTAATTGG + Intergenic
1179322126 21:40302129-40302151 TTTAGTATATTGTGGTGAGCCGG + Intronic
1180652371 22:17388816-17388838 TTTAGTATTTTTTTTTGAGGTGG + Intronic
1181008106 22:20024014-20024036 TTTTGTATTTTGTTTTTAGTAGG - Intronic
1183057746 22:35317482-35317504 TTTAGAATTATCTTTTGAGCTGG - Intronic
1183808013 22:40228689-40228711 TTTTGTATTTTTTTTTTAGTAGG + Intronic
1184076745 22:42184497-42184519 TTTATTCTATACTTTTTACCTGG + Intronic
1184120591 22:42447249-42447271 TTCAGTATATTCCTTTTCCCAGG - Intergenic
949092489 3:45320-45342 TTTAATCTATTTTTTTTAACAGG + Intergenic
949111646 3:268528-268550 TTTATTTTATTTTTTTTAGATGG - Intronic
949540557 3:5028869-5028891 TTTATTTTATTTTTTTTAGACGG + Intergenic
951231311 3:20182614-20182636 TTTAGGATATTCTTTGTGTCTGG - Intronic
952024863 3:29067551-29067573 TTTACTATATTTTTATTACCTGG + Intergenic
953159837 3:40408316-40408338 TTTAGTATATGTTTTTAAGAGGG - Intronic
954061380 3:48070688-48070710 TTTAGTATTTTCTTATTAAAAGG + Intronic
954570265 3:51634954-51634976 TTTACTATATTTTTTTCAGAGGG + Intronic
955629122 3:60953014-60953036 TTTAGGGTTTTCTTTTCAGCTGG - Intronic
956360610 3:68442781-68442803 TTTAATCTATTCTTTTCTGCAGG - Intronic
956855107 3:73268566-73268588 TTTATTTTATTTTTTTGAGCCGG + Intergenic
957032749 3:75261397-75261419 TTTAATCTATTTTTTTTAACAGG + Intergenic
957269480 3:78011082-78011104 TTTATTTTATTTTTTTTAGATGG + Intergenic
957341790 3:78908490-78908512 TTTAATATATTCATTTTAAATGG - Intronic
957888853 3:86328419-86328441 TTTAGTGTATTTTTTTTTGGTGG + Intergenic
957998191 3:87717773-87717795 TTTAGTACACTGTTTTTGGCTGG - Intergenic
958137610 3:89516502-89516524 TTTTGTATATAGTTTTTATCAGG + Intergenic
958642852 3:96830360-96830382 TTTGGTATTTTCTTTTTTTCTGG - Intronic
958891285 3:99785957-99785979 TTTACGATATTCTTTTTTCCTGG - Intronic
959781062 3:110233925-110233947 TTTTGTTTATTATTTTTAACTGG - Intergenic
960181138 3:114581026-114581048 TTTATAATATTCTTTTTACTTGG - Intronic
960633568 3:119758603-119758625 CTTGATATTTTCTTTTTAGCAGG - Intronic
961065658 3:123873298-123873320 TTTTGTAGATACTTTTTATCAGG - Intronic
961161003 3:124725712-124725734 TTTAGTTTATTCTGTTTATCTGG + Intronic
961560626 3:127726442-127726464 TTTTTTATTTTCTTTTTAGTAGG + Intronic
961806496 3:129492987-129493009 TTTTGTATATTTTTTAGAGCAGG + Intronic
961937176 3:130597684-130597706 TGTGGGATATTCTCTTTAGCAGG - Intronic
962132523 3:132697037-132697059 TTTAGTATATAATATTAAGCAGG - Intronic
962503328 3:136018444-136018466 TTTATAATATTCTTTTTTTCTGG - Intronic
964583169 3:158263163-158263185 TTTAGTAGATTCCTTTTGACAGG + Intronic
964834481 3:160922303-160922325 TGTAATATATTTTTTTTAGACGG - Intronic
964887342 3:161499697-161499719 TATATTAAATTCTTCTTAGCAGG - Intronic
965230270 3:166041970-166041992 TTATGTATCTTTTTTTTAGCGGG - Intergenic
965460609 3:168957434-168957456 TTCACTGTATTCTTTTTAGTGGG - Intergenic
965724853 3:171704339-171704361 GTTAGTATTTTTGTTTTAGCAGG - Intronic
966450134 3:180049714-180049736 TTTAGTATTTTGTATTTAGTAGG - Intergenic
966599684 3:181762619-181762641 TTAAGTATTTTTTTTTTAGACGG - Intergenic
966952261 3:184831965-184831987 TTTAGTATACTATATATAGCAGG - Intronic
967295019 3:187956103-187956125 TCTAGAAAACTCTTTTTAGCTGG - Intergenic
968318483 3:197744713-197744735 TACAGTATATACTTTTTAACTGG - Intronic
969149147 4:5153557-5153579 TTTGGTAAATGCTTTTTATCAGG - Intronic
970189975 4:13505943-13505965 TTTTGTAAATTATTTTTATCAGG - Intergenic
971076027 4:23151153-23151175 TTTGGTTTATTATTATTAGCAGG - Intergenic
971291320 4:25343498-25343520 TTTAGTATATGCTATGTAGCTGG + Intronic
971946358 4:33284082-33284104 TTTAGTATTTTTTCTTTAGGAGG + Intergenic
972098193 4:35376507-35376529 TTTATTGTAGTCATTTTAGCGGG - Intergenic
973309121 4:48688009-48688031 TTTACCATAATCTTTTTACCTGG - Intronic
973710963 4:53630014-53630036 TTAAGTGTCTTCTTTTTTGCTGG - Intronic
973808189 4:54545578-54545600 TTTATTGGATGCTTTTTAGCTGG - Intergenic
974091406 4:57315312-57315334 TTTATTTTATTTTTTTTAGACGG + Intergenic
975076842 4:70220186-70220208 TTTAGTTTTTTTTTTTTAGAAGG - Intergenic
975448098 4:74491433-74491455 TTAAATATATTCTTTTTAATTGG + Intergenic
976248181 4:83024482-83024504 TTTAGGATTTTCTTTTTGGCTGG + Intergenic
977299168 4:95248206-95248228 TTTAGGATTTTTTTTTTGGCTGG + Intronic
978053501 4:104234138-104234160 TTAAGTTTATACTTTTCAGCTGG - Intergenic
978130777 4:105194114-105194136 TTTATTATTTTTTTATTAGCAGG - Intronic
978259138 4:106731967-106731989 TTTAATATATTTTATTTAACAGG + Intergenic
978555088 4:109971340-109971362 TTTAAAATATTCTTTTAAGTAGG - Intronic
979131063 4:117045230-117045252 TTTAATATATTCTATATATCAGG + Intergenic
980140576 4:128911260-128911282 TTTATTATATTTTTTTGAGACGG - Intronic
980254982 4:130367973-130367995 TTTAGTTTATCCTTTTTGACAGG + Intergenic
980293654 4:130879350-130879372 CTTAATATATTCTTTTTTGCAGG + Intergenic
980616703 4:135237015-135237037 TTTAGTATAATATTTTTATTAGG + Intergenic
980656970 4:135801406-135801428 TATAATATACTCTTTTTACCAGG - Intergenic
980921969 4:139095495-139095517 TTTAATATATACTCTTTATCAGG + Intronic
981694938 4:147550592-147550614 TTTAGTATATTATATTAAGATGG - Intergenic
982408520 4:155046401-155046423 TGTAGTATATCCTCTCTAGCAGG - Intergenic
982756221 4:159221546-159221568 TTTATATTATTATTTTTAGCAGG - Intronic
982991360 4:162279989-162280011 TTTATTATATGCTTATTTGCTGG - Intergenic
984734189 4:183095902-183095924 TTTATTTTATTTTTTTTAGATGG + Intergenic
985030074 4:185780734-185780756 TTAAGTAAATACTTTTTAGTAGG + Intronic
985498987 5:228895-228917 TTTAGTAGGTTGTTTTTAGTAGG - Intronic
985858359 5:2448872-2448894 TTTAGTACCTACTTCTTAGCAGG + Intergenic
986343886 5:6816487-6816509 TTGAGTATAGTCTTTCTAGTGGG + Intergenic
986939397 5:12932061-12932083 TTTAGTTTTTTTTTTTTAACTGG - Intergenic
987666971 5:20955494-20955516 TTTTGTATATTCTGTAGAGCTGG - Intergenic
987719862 5:21619308-21619330 CTAAGTACATTCTTTTTAGGGGG - Intergenic
988154238 5:27429574-27429596 TTTAATATAATATTTTTAGCAGG + Intergenic
988454114 5:31372490-31372512 TGTAGTACATTCTTCTTACCTGG + Intergenic
989515225 5:42335738-42335760 TTTTGTAGATACTTTTTATCGGG - Intergenic
989636256 5:43538076-43538098 TTAAGTATATGCTTGTTAGTAGG - Intronic
989830240 5:45907810-45907832 TTTAGTATAGTCATTCTAGTTGG - Intergenic
990349230 5:54899248-54899270 ATTAGAATATCCTTTTTAGCTGG - Intergenic
990884891 5:60580080-60580102 TTTACTTTATTCTTTTTGGAAGG + Intergenic
991020749 5:61977613-61977635 TTTGGTATTCTCTTTTCAGCTGG - Intergenic
991320285 5:65365746-65365768 TTTAGTATATCTTTTATAGATGG + Intronic
991348705 5:65698249-65698271 TTTAGTATTTACTTTTTTGGGGG - Intronic
991531828 5:67624036-67624058 TTTATTGTATTCTTTTTTTCAGG + Intergenic
992045895 5:72889060-72889082 TTTATTTTATTTTTTTTAGATGG + Intronic
992279484 5:75159706-75159728 TTTAGTATTTCCTTTAAAGCAGG - Intronic
992978923 5:82146314-82146336 TTTAATATATTGTTTTTCTCTGG + Intronic
993385356 5:87256020-87256042 TTTATAATCTTCTTTTTACCAGG + Intergenic
993725100 5:91357918-91357940 TTTTGTCTATTTTTTTTAGTTGG - Intergenic
994162641 5:96573867-96573889 TATAGTATATTCTTTGTTTCTGG + Intronic
994384165 5:99109049-99109071 TTCTGTATATTCATTATAGCAGG + Intergenic
994489957 5:100428442-100428464 TTTAGGATATTATCTTTACCTGG - Intergenic
994511730 5:100712110-100712132 TTCAGTATATGCATTTTAGATGG - Intergenic
995279267 5:110315074-110315096 TTTGATATATTCTTTTTGGGGGG - Intronic
995419785 5:111951357-111951379 TTTAGTATTTTTTTTACAGCAGG + Intronic
996116500 5:119625872-119625894 TTTAAAATATTCATTCTAGCTGG - Intronic
996350694 5:122538479-122538501 TATAGAATATTCTTTTGGGCCGG + Intergenic
998440725 5:142159738-142159760 TTTAGTATACTGTTTTTAGAAGG - Intergenic
1000099258 5:157999021-157999043 TTTGGTATTTTCTTTTAAGATGG - Intergenic
1000227682 5:159281899-159281921 ATTAGTATATTCTTTTGATTTGG - Intronic
1000524407 5:162338596-162338618 TTTAGTTTTTACTTTTTAGATGG - Intergenic
1000875149 5:166627925-166627947 TGTACTATATCCTTTTTAGGAGG - Intergenic
1001338565 5:170822710-170822732 TTTATTAGATTCTTTTTATGTGG - Intergenic
1001621495 5:173089381-173089403 TTTTGTATATACTTTTTAATTGG + Intronic
1001887289 5:175304561-175304583 TTTATTTTATTCTTTTCAGTGGG - Intergenic
1004042110 6:11989988-11990010 TTTATTTTATTGTTTTTGGCCGG + Intergenic
1005613902 6:27554394-27554416 TTTAATATATTATATTTAACCGG + Intergenic
1005915523 6:30347431-30347453 TTTGGTATAACCTTATTAGCTGG - Intergenic
1007565398 6:42846361-42846383 TTTATTTTATTTTTTTGAGCCGG - Intronic
1007653419 6:43437386-43437408 TTTTTTATATTTTTTTGAGCAGG + Intronic
1008714973 6:54277228-54277250 TTTACTTTATTCTTTTTACTGGG - Intergenic
1009280088 6:61738309-61738331 TTGAGTATTTTCTTTTTTGTGGG - Intronic
1009352437 6:62698093-62698115 TTTATTTTATTTTTTATAGCAGG - Intergenic
1009449826 6:63787933-63787955 TTTACTATTTTTTTTTTAGATGG - Intronic
1009728926 6:67573729-67573751 TTTAGTGTCTTCTCTTTACCTGG + Intergenic
1009828757 6:68901953-68901975 TTTAATTTATATTTTTTAGCTGG + Intronic
1010355927 6:74933086-74933108 TTTAGTTTATTTTTTTTAGGGGG - Intergenic
1010436077 6:75832914-75832936 TTTTGTATTTTCTGTTTTGCCGG - Exonic
1010802828 6:80197845-80197867 AGTAGTATATTCTACTTAGCAGG - Intronic
1010823272 6:80441772-80441794 TTTGGTATATATTTTTTGGCTGG - Intergenic
1011266935 6:85531612-85531634 TTTAGTATATTGATTTTATACGG - Intronic
1011352786 6:86440964-86440986 TTTACTATATTCTATTTAAATGG - Intergenic
1011388720 6:86826764-86826786 TTTATTATATTTTTTTAAGTTGG + Intergenic
1011936409 6:92784094-92784116 TTAACTTTATTCTTTTTAGTGGG + Intergenic
1012482888 6:99687835-99687857 TTTAGTAAATTCTCTTTATCAGG + Intergenic
1012994642 6:105961029-105961051 TTTGTTTTATTCTTTTTAGTTGG + Intergenic
1014755161 6:125294595-125294617 TTTAGTTCATTCTTTTCAACTGG - Intronic
1015675707 6:135745880-135745902 TTTAGTATATTTTTATTAAATGG + Intergenic
1016613912 6:146025480-146025502 TCTAGTATGTGATTTTTAGCAGG - Intergenic
1017238126 6:152138609-152138631 TTTAGTATATGCTTTTTATTTGG - Intronic
1017858683 6:158375286-158375308 TTTAGTATGTTCTTTTTTGTTGG + Intronic
1018017058 6:159721985-159722007 TTTATTTTATACTTATTAGCTGG + Intronic
1018520982 6:164652083-164652105 TTCGGTAGATTCTTTTTATCAGG + Intergenic
1020159240 7:5755772-5755794 TTTGGTGTACTCATTTTAGCTGG + Intronic
1020597549 7:10227538-10227560 GTTATTATTTTGTTTTTAGCTGG - Intergenic
1020708236 7:11572508-11572530 TTTAGTAGTTTCTTTTTGGGGGG + Intronic
1021825801 7:24549969-24549991 TTTAGTATATTTTATTTGGAAGG - Intergenic
1022009789 7:26298995-26299017 TTTACTATATGCATTTTGGCAGG + Intronic
1022076543 7:26976587-26976609 TTTATTATTTTTTTTTTAGAAGG - Intronic
1022208633 7:28186642-28186664 TTTATTTTTTTTTTTTTAGCCGG + Intergenic
1022650469 7:32269482-32269504 TTTGGTTTTTTCTTTTTAGATGG + Intronic
1024801144 7:53080886-53080908 TTTGTTATATTCTTTTTTGGGGG - Intergenic
1026289459 7:68993269-68993291 TTTAAAACATTCTTTGTAGCTGG + Intergenic
1026464633 7:70643563-70643585 TTTATTTTATTTTTTTTAGACGG - Intronic
1027974530 7:85134154-85134176 TTAAGTATGTTCTTTTTATTAGG - Intronic
1028034851 7:85969291-85969313 ATTACTATATTCTTTCTAGTCGG - Intergenic
1028067452 7:86405205-86405227 TTTAGTATTTTCTGTTTCTCTGG - Intergenic
1028081361 7:86581288-86581310 TTTAGTATTTATTTTCTAGCAGG - Intergenic
1028203829 7:87994060-87994082 TTTAGTGTATTCTTTATATCAGG - Intronic
1028425966 7:90689288-90689310 TTTATGATTTTCTTTTTATCTGG + Intronic
1028662160 7:93291054-93291076 TTTATTTTATTCTATTTTGCAGG - Intronic
1028748250 7:94352503-94352525 TCTAGTCTATTCCTTTTAACTGG + Intergenic
1029311627 7:99672380-99672402 TCTAGTATATTCATATTATCAGG - Intronic
1030292139 7:107883410-107883432 TTTGTTATATTATTTTTAACTGG - Intergenic
1030417162 7:109259991-109260013 TTTACTTTATTTTTCTTAGCAGG - Intergenic
1030744948 7:113153734-113153756 TTTATTATTTTTTTTTTAGGGGG + Intergenic
1030854126 7:114529820-114529842 ATCAGTATATTCTCTTTAGTGGG + Intronic
1031013966 7:116552216-116552238 ATTAATATATTCTTTTCATCTGG - Intronic
1031439436 7:121775160-121775182 TTTAGAATATTCTTCTGAGTGGG - Intergenic
1031519234 7:122743193-122743215 TTTAGTTTTTTCTTTTTACAAGG - Intronic
1031567457 7:123318619-123318641 TCTAGTATATTCTTATTGGGCGG + Intergenic
1031573344 7:123385998-123386020 TTTAATATATACTTTTTTGGGGG - Intergenic
1032253717 7:130280250-130280272 ATTTGCACATTCTTTTTAGCTGG - Intronic
1032272885 7:130427603-130427625 TTAAGTATATTCCTTTAAACTGG - Intronic
1032314677 7:130824610-130824632 TTTATTATATTTTTATTAGGTGG + Intergenic
1032371898 7:131364113-131364135 TATAGTATACTCTTTATAGCTGG + Intronic
1032807897 7:135375918-135375940 TTTTGTATATTTTTTTGAGACGG - Intronic
1032844800 7:135743377-135743399 TTTATTTTATTTTTTTTAACTGG + Intronic
1033112076 7:138588832-138588854 TTTTGTATATTCTGTTGAGGTGG - Exonic
1033234840 7:139630130-139630152 TTTATTATTTTCTTTTTACCAGG + Intronic
1033571332 7:142631760-142631782 TTAAGAATATTCTTTTTTCCTGG + Intergenic
1033777884 7:144633160-144633182 TATAGTCTATGCTTTTCAGCTGG + Intronic
1033792155 7:144803581-144803603 TTTAGAATATTCTTTGTAAGAGG - Intronic
1035105494 7:156438992-156439014 TTTATTTTATTTTTTTTAGATGG - Intergenic
1035425420 7:158768729-158768751 TTTAATATATCTTTTTTGGCCGG + Intronic
1036379363 8:8227512-8227534 TTCAGGAAAGTCTTTTTAGCAGG - Intergenic
1036622008 8:10430435-10430457 TTTAGTTTATTCTATTTAATTGG + Intergenic
1037151935 8:15647287-15647309 TTAAATATATTCTTTTGAGCGGG - Intronic
1037210524 8:16380880-16380902 TTTAGTAAAATATTTTTATCTGG - Intronic
1038007002 8:23439965-23439987 TTTAGACTTTTCTTTTTAGTAGG - Intronic
1038320595 8:26522671-26522693 CTTTGTACATTTTTTTTAGCTGG + Intronic
1038662357 8:29508120-29508142 TTTAGAATATTCTTTGAAACTGG + Intergenic
1038849254 8:31258515-31258537 TCTAGGGAATTCTTTTTAGCAGG + Intergenic
1039428242 8:37504825-37504847 TCGCGTAGATTCTTTTTAGCGGG - Intergenic
1039863811 8:41483328-41483350 TTAAATATATTCTTTTAAACTGG + Intergenic
1041462225 8:58123448-58123470 TTTATTATTTTCATTTTAACAGG + Intronic
1041813927 8:61944911-61944933 TTTATTATACTTTTTTAAGCTGG + Intergenic
1041988519 8:63955805-63955827 TTTATTATCTTCCTTTAAGCTGG - Intergenic
1043618013 8:82151914-82151936 TTTAGTTTATTACTTTTTGCAGG + Intergenic
1044196702 8:89385524-89385546 TTTAATATATTTTTTTGAGACGG - Intergenic
1044529404 8:93290635-93290657 TTTATTTTATTTTTTTTAGATGG + Intergenic
1044919598 8:97154892-97154914 TTTTGTAGATGCTTTTTATCTGG - Intergenic
1045069515 8:98486823-98486845 TTTAGTAGATTTTTTTCAGTAGG + Intronic
1045188939 8:99864654-99864676 TTTAATATATTTTTATTAACTGG - Intronic
1045753699 8:105516220-105516242 TTCAGTTTATTCTTTTTGGCTGG - Intronic
1046922211 8:119743431-119743453 TTTCGTATATGCTTTTTCCCTGG - Intronic
1047289631 8:123518277-123518299 TCGAGTATATTCTTTGTAGCAGG - Intronic
1049314529 8:141956073-141956095 TTTAGGATTTTCTCTTTAACTGG - Intergenic
1050467739 9:5948301-5948323 TATATTATATTCTTTTTAAAAGG + Intronic
1050471038 9:5990258-5990280 TTTAGTATAATATTTTTAGTAGG + Intronic
1050534140 9:6616911-6616933 TTTGGTATATTTTTGTCAGCAGG - Intronic
1051043009 9:12837564-12837586 TTTAGTCTTTTATTCTTAGCTGG + Intergenic
1051545786 9:18272922-18272944 ATTAGTATATTATTTTTAATGGG + Intergenic
1052038826 9:23714801-23714823 TTCAGTATTTTTTTTTTAACTGG - Intronic
1052776693 9:32739744-32739766 TGGAGGATTTTCTTTTTAGCAGG - Intergenic
1052907746 9:33851579-33851601 TTCTTTATATTCTTTTTAGGTGG + Intronic
1052973080 9:34390271-34390293 TTTTGTATATATTTTTTATCAGG + Intronic
1053393136 9:37750603-37750625 TTTTGTATTTTTTTTTTAGACGG - Intronic
1054897099 9:70326610-70326632 TTTAATTTTTTTTTTTTAGCTGG + Intronic
1055892299 9:81136218-81136240 TTTAGTAAATTGTTATTATCTGG - Intergenic
1056120361 9:83481778-83481800 TTTAGTTTCTTCTTTCCAGCAGG + Intronic
1056247924 9:84716519-84716541 TATAGCATATTCTTTTAATCTGG - Intronic
1056494094 9:87138898-87138920 TTAAATATAGTCTTTTTAACAGG - Intergenic
1057545105 9:96013689-96013711 TTAAGTATTTTCTTTTTCCCTGG + Intronic
1058115553 9:101080616-101080638 TTTAGAATTTTCTCTTTGGCTGG + Intronic
1058253132 9:102727626-102727648 TTTGGTATTTTCTTTTTTGGGGG - Intergenic
1058867327 9:109172729-109172751 TTTAATATATTTTTTTTTGAGGG - Exonic
1058965022 9:110029265-110029287 TCTAGGATCTTCTTTTTAGTTGG + Intronic
1059303062 9:113331113-113331135 TTTTCTATACTCTTTTTAGCAGG - Exonic
1059360301 9:113736951-113736973 TTTATTGTATTTTTTTTTGCGGG + Intergenic
1060082902 9:120668695-120668717 TATAGTATATGCTTAATAGCTGG - Intronic
1060649136 9:125309821-125309843 TTTTGTATAGTCTTGTTACCTGG + Intronic
1062620495 9:137418443-137418465 TTTAGTATCTTATTTTTATATGG + Intronic
1187675738 X:21714627-21714649 TTAAGTATCTTCTGTATAGCAGG - Intronic
1187993913 X:24905270-24905292 GTTGGTATTTTCATTTTAGCAGG - Intronic
1188714585 X:33446334-33446356 TTTAGCATTTTCTCTTTAGTTGG + Intergenic
1188736939 X:33728311-33728333 TTTAGTACATTCCCTTTGGCTGG - Intergenic
1188955341 X:36428768-36428790 TATAGTATATTCTGTTTAACTGG + Intergenic
1189918348 X:45879003-45879025 TTAAGTATAATTATTTTAGCAGG + Intergenic
1190537530 X:51444769-51444791 TTTTGTATATGCTATTTATCAGG - Intergenic
1190540009 X:51467710-51467732 TTTAGTATATGCTTTTGAGCAGG - Intergenic
1191931782 X:66381503-66381525 TTTATGATATTAATTTTAGCAGG + Intergenic
1192415016 X:70971781-70971803 TTTAATATATTGTTTTAGGCTGG - Intergenic
1193085060 X:77441572-77441594 TCATGTATATTCTTATTAGCAGG + Intergenic
1194169661 X:90565498-90565520 TGTAATATATTCTTTTTTGAGGG + Intergenic
1195279366 X:103315815-103315837 TTTGGTACATTCTTTATAGAAGG + Intergenic
1195304349 X:103564807-103564829 TTTAGTACATTCATTTTTACTGG - Intergenic
1196907708 X:120453801-120453823 TTTATTTTATTATTTTGAGCTGG - Intronic
1197381031 X:125739128-125739150 TTAAATCTTTTCTTTTTAGCAGG - Intergenic
1197505098 X:127292147-127292169 TTTAGTTTATACATTCTAGCAGG + Intergenic
1198636392 X:138705798-138705820 TTTAATATATTATTTTGATCAGG + Intronic
1198993258 X:142541629-142541651 CGCAGTATATTCCTTTTAGCTGG - Intergenic
1199140641 X:144307742-144307764 TTTAATTTATTTTTTTTAGACGG + Intergenic
1200515901 Y:4143272-4143294 TGTAATATATTCTTTTTTGAGGG + Intergenic
1200968894 Y:9128659-9128681 TTTGGAATAATCTTTTTGGCAGG + Intergenic
1201401565 Y:13609345-13609367 TTTAGGAAATTCTTTTTTTCTGG - Intergenic
1201493534 Y:14568549-14568571 TTTAGTTTTTCCTTTTTATCTGG - Intronic
1201561886 Y:15326448-15326470 TTTAGTAGATTCCCTTTATCAGG + Intergenic
1202141930 Y:21733842-21733864 TTTGGAATAATCTTTTTGGCAGG - Intergenic
1202144935 Y:21769960-21769982 TTTGGAATAATCTTTTTGGCAGG + Intergenic
1202391259 Y:24372813-24372835 CTTAGTATCTTCTTTTTATCGGG + Intergenic
1202479526 Y:25297304-25297326 CTTAGTATCTTCTTTTTATCGGG - Intergenic
1202580263 Y:26373253-26373275 TATAGAAAATACTTTTTAGCTGG + Intergenic