ID: 928065473

View in Genome Browser
Species Human (GRCh38)
Location 2:28160292-28160314
Sequence TTAGTATATTCTTTTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065471_928065473 -10 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065466_928065473 13 Left 928065466 2:28160256-28160278 CCAGGACTAGCCACTGCGCCTGG 0: 1
1: 0
2: 1
3: 40
4: 349
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065468_928065473 3 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065465_928065473 22 Left 928065465 2:28160247-28160269 CCTGGGATTCCAGGACTAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065464_928065473 29 Left 928065464 2:28160240-28160262 CCAAAAACCTGGGATTCCAGGAC 0: 1
1: 0
2: 4
3: 90
4: 2759
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348
928065470_928065473 -5 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065473 Original CRISPR TTAGTATATTCTTTTTAGCT GGG Intronic
903101236 1:21031500-21031522 TTCTTATATTCTTTATATCTTGG - Intronic
903741172 1:25559541-25559563 TTAGTGTATTCTTCTCAGGTTGG + Intronic
904279909 1:29411709-29411731 TTAGTAGATACTTGTTAGCCAGG - Intergenic
904942404 1:34173784-34173806 TCTGTAAATTATTTTTAGCTTGG - Intronic
906647091 1:47483071-47483093 TTAGTATATTCCTTGTATTTTGG + Intergenic
906796991 1:48705362-48705384 TTAATGTTTTCATTTTAGCTTGG - Intronic
906853388 1:49278274-49278296 TTAGTATTTCCTTTTAACCTGGG - Intronic
908257331 1:62313849-62313871 TTATTATTTTACTTTTAGCTTGG - Intronic
911805779 1:102206322-102206344 TTAGTTTAATCTATTTATCTTGG + Intergenic
912826194 1:112905752-112905774 TTTGTATATGCTTTTTAGAATGG - Intergenic
912901472 1:113654599-113654621 TTAGAATATTCTGTTAAACTTGG - Intronic
913132127 1:115850084-115850106 TTAATTGATTCTTTCTAGCTGGG + Intergenic
913368926 1:118074778-118074800 TTAGTATAATTTTTCTAGGTAGG - Intronic
915524465 1:156467457-156467479 TTATTATATTTTTTTTAATTTGG - Exonic
916095010 1:161341456-161341478 TTAGTACATCCTTTTTAGGTAGG + Intronic
916516311 1:165520470-165520492 TTACTAGATTCTTGTTAGCCTGG - Intergenic
918252618 1:182716954-182716976 TTAGTATGTTCGTTATACCTTGG - Intergenic
918364228 1:183789615-183789637 TTAGTATATTATTATAAGCAAGG + Intronic
918545934 1:185683875-185683897 TTAAAATAGTCTATTTAGCTGGG - Intergenic
919167148 1:193909988-193910010 ATAGTATATTTATTTTAGTTTGG + Intergenic
919382372 1:196874891-196874913 TTAGTGTATACTTCATAGCTAGG - Intronic
919679333 1:200418958-200418980 ATAATAAATTCATTTTAGCTGGG - Intergenic
919954360 1:202398069-202398091 ATAGAAAATACTTTTTAGCTGGG - Intronic
922009977 1:221573596-221573618 TTTATATATTCTTTTGAGCAAGG + Intergenic
1063303755 10:4877410-4877432 TTTGTTTATTTTTTTTAGGTGGG - Intergenic
1063737408 10:8775458-8775480 TTACTATATTCATTTTAGTGAGG + Intergenic
1064897828 10:20259132-20259154 TTAATATATATTTTTTAACTTGG - Intronic
1065027634 10:21553998-21554020 TTAGTATTTTCTCTTTAACCTGG + Intronic
1065224573 10:23530318-23530340 TTAGTTTATTCCTTTTAAATTGG - Intergenic
1065666785 10:28071623-28071645 TTCATATATTATTTTTAGTTAGG - Intronic
1065928977 10:30462317-30462339 TTATTATTTTATTTTTAGCAGGG - Intergenic
1067988046 10:51174366-51174388 ATACTAAATTCTTTTTAGCATGG + Intronic
1068159022 10:53239732-53239754 TTGGAATAATCTCTTTAGCTGGG - Intergenic
1068891213 10:62149870-62149892 TTAGTGTATTTTTTTTAGAATGG - Intergenic
1069151391 10:64965432-64965454 TTAGAATTTTTTTTTTATCTGGG - Intergenic
1069202143 10:65633475-65633497 TTATTATATTCTTTATTTCTAGG - Intergenic
1069211433 10:65765654-65765676 TCAGTATCTTCTTGTTATCTAGG + Intergenic
1069538751 10:69277270-69277292 TTAAAATTTTCTTTTTGGCTGGG + Intronic
1070185061 10:74054099-74054121 AAAGTATATTCTCTTTTGCTTGG + Intronic
1071265912 10:83964813-83964835 TTACTCTATTCTTTTTGCCTGGG - Intergenic
1071922060 10:90361532-90361554 TTAGTACCTTCTCCTTAGCTGGG + Intergenic
1072007214 10:91263967-91263989 TTACTATCTTCTTATTAGTTTGG - Intronic
1072170099 10:92850300-92850322 TTATTCTGTTCTTTTTTGCTGGG + Intronic
1072237076 10:93462581-93462603 TTAGTTTTTCCTTATTAGCTAGG - Intronic
1072671971 10:97437037-97437059 TTATTTTTTTCTTTTTTGCTTGG - Intronic
1072873916 10:99151578-99151600 TTAAGATTTTCTTTTTATCTTGG - Intronic
1072981365 10:100100599-100100621 TTATTAAATTCTTATTGGCTTGG + Intergenic
1074279877 10:112040927-112040949 TTAGTTTATCCTTGTTGGCTGGG - Intergenic
1074658372 10:115620527-115620549 TTAGCATATATTTTTTAGCCTGG - Intronic
1074720363 10:116258959-116258981 TATATATATTCTTCTTAGCTTGG - Intronic
1074757145 10:116632412-116632434 TTAGTCTATTTTTCTGAGCTGGG + Intronic
1079967926 11:27001665-27001687 ATAGTATATATTTTTTAGTTTGG - Intergenic
1080350656 11:31382061-31382083 TTAGTATATACTGTTTTTCTAGG + Intronic
1080834814 11:35930194-35930216 TTATTATATTCTGTATAGGTGGG - Intergenic
1081096952 11:38948217-38948239 TTAGTATTTTTTGTTTAGTTGGG + Intergenic
1081467426 11:43334500-43334522 TTAGTATACTCATTTTAACTGGG + Intronic
1081834264 11:46141261-46141283 TAAATATATTCTATTTGGCTGGG + Intergenic
1082783502 11:57303876-57303898 TTTGTATTTTGTTTTTAGATGGG - Intronic
1083006724 11:59354028-59354050 TTCACATATTCTTTTTTGCTTGG + Intergenic
1086555235 11:88102578-88102600 TGAATATATACTTTTTAGCTGGG - Intergenic
1086648752 11:89259890-89259912 TTATATTATTCTTTTTAGTTAGG + Intronic
1088083789 11:105953570-105953592 TTACTATTTTCTTATTAGCATGG + Intronic
1088427255 11:109717510-109717532 TTATTAGCTTCTTTTTAGATTGG + Intergenic
1089891126 11:121882242-121882264 TAAATTTAATCTTTTTAGCTTGG + Intergenic
1090857910 11:130626580-130626602 TTACTTTTTTCTTTTTAGCATGG - Intergenic
1092781278 12:11990067-11990089 TTTATATATTTTTATTAGCTTGG + Intergenic
1093064710 12:14644976-14644998 TTATTATATTCTTTGTAGTCTGG - Intronic
1094003581 12:25723377-25723399 TTAGTTGATTCTTGTTGGCTGGG - Intergenic
1094711848 12:32972122-32972144 TGATTATATTCTTCTTAGCAAGG + Intergenic
1095341117 12:41089425-41089447 TTATTATTTTTTTTTTAGCGGGG - Intergenic
1095681763 12:44985514-44985536 TTATTCTCTTCTTTTTAGTTTGG + Intergenic
1096010922 12:48213670-48213692 TCAGTATTTTCTATTTATCTGGG + Intergenic
1096874883 12:54620419-54620441 TTAGTTCATTCTTTTGAGGTGGG + Intergenic
1097349567 12:58533729-58533751 TTAGGATATTGTATTTAGTTTGG + Intergenic
1098056010 12:66505998-66506020 TTATTATATTCTTTTCAGAATGG + Intronic
1098606750 12:72400048-72400070 TTGTTATATTCTTTTTGTCTAGG + Intronic
1098980394 12:76949858-76949880 TAAGAATATTCTTGTTAGTTTGG + Intergenic
1099047577 12:77741066-77741088 TTGATATATTCTTTCTAACTAGG + Intergenic
1099049491 12:77766147-77766169 TAAGTTTATTTTTATTAGCTGGG - Intergenic
1099752386 12:86792566-86792588 ATAGTTTATTTTTTTTAACTGGG - Intronic
1100542865 12:95574290-95574312 TTATTCTGTTCCTTTTAGCTTGG + Intergenic
1101563325 12:105881142-105881164 TTACAATTTTCTTTTTAGCAAGG + Intergenic
1102245041 12:111350344-111350366 TTAGTATAGTCTTTTGAACACGG + Exonic
1102494357 12:113309148-113309170 TTAATATTTTCATTTTGGCTGGG - Intronic
1103586499 12:121960227-121960249 TTAGTATTTTTTTTTTTGATAGG + Intronic
1103636066 12:122306421-122306443 TGAGTATCTTGTTTTTAGCCAGG - Intronic
1104290207 12:127459792-127459814 GTTTTATTTTCTTTTTAGCTGGG - Intergenic
1105901636 13:24759762-24759784 TTATTGTTTTCTTTTTAACTTGG - Intergenic
1105907357 13:24826148-24826170 TTAATATATTCTTCTTTCCTGGG + Intronic
1106357125 13:28993787-28993809 TTACTGTCTTCTTTTTTGCTTGG + Intronic
1106748873 13:32736287-32736309 TTAGTACTTTTTTTTTAGTTTGG + Intronic
1106826229 13:33523728-33523750 TCTGTATATTATTTTGAGCTTGG + Intergenic
1109800033 13:67364579-67364601 TTAATATATACTTTTCAGTTAGG - Intergenic
1109810340 13:67505235-67505257 TTAGTATGTTCTCTTCAGTTAGG - Intergenic
1110216357 13:73028882-73028904 GTATTATATTCTATTTAGATAGG - Intergenic
1110373049 13:74760797-74760819 TTATTATACTCTTTTTCCCTTGG - Intergenic
1111065022 13:83079473-83079495 TTAGTATATATTTTGTTGCTTGG + Intergenic
1111604964 13:90525758-90525780 TTAATATAATCTTTTCAGTTTGG - Intergenic
1111997210 13:95176487-95176509 TTATTATTTTTTTTTTAGATAGG - Intronic
1116001747 14:39250270-39250292 TTCGTACATTTTATTTAGCTGGG + Intronic
1116495411 14:45553877-45553899 TTACTTAATTTTTTTTAGCTGGG - Intergenic
1116662760 14:47732927-47732949 TTACAATATTTTTTTCAGCTTGG + Intergenic
1117590132 14:57258891-57258913 TTACTTTATTTTTTTTACCTAGG - Intronic
1117820828 14:59646987-59647009 TTACTATATGCTTTTTAAATGGG - Intronic
1120274633 14:82356047-82356069 TTTGTATTTTCTTTTTAAATTGG + Intergenic
1120836389 14:89041544-89041566 TTAGTTTATTCTTTTTCACTTGG + Intergenic
1120876969 14:89383948-89383970 ATAGCATTTTTTTTTTAGCTGGG - Intronic
1120941345 14:89953249-89953271 GTTGCATATTCTTTTTAGCCAGG - Intronic
1121985661 14:98502888-98502910 TTAATATATTATCTTTAGTTTGG - Intergenic
1122525853 14:102383758-102383780 TTAGTATTTGTTTTTTAGTTTGG - Intronic
1124684109 15:31764698-31764720 TTAGTATTTTTTTTTAATCTAGG - Intronic
1126033197 15:44520925-44520947 TTTCTATATTCTCTTTAGATTGG + Intronic
1129451745 15:75654979-75655001 TCAGTATCTCCTCTTTAGCTAGG + Intronic
1130291105 15:82601959-82601981 TTTCTATATTCTTTTTTGCAGGG - Intronic
1133143276 16:3764003-3764025 TTTGTTTTTGCTTTTTAGCTGGG - Intronic
1137633075 16:49961389-49961411 TTAGTAAATTACTCTTAGCTGGG - Intergenic
1137940739 16:52681556-52681578 ATAGTCTATTATTTTTATCTGGG - Intergenic
1138249950 16:55494267-55494289 TAAGTATCTTCTTTGTACCTTGG + Intronic
1138801142 16:60031487-60031509 TTAGTTTATATTTTTTAGGTAGG + Intergenic
1144769882 17:17753547-17753569 TTAATACATTGTTATTAGCTTGG - Intronic
1145185405 17:20789820-20789842 TTATTAAATTAATTTTAGCTGGG + Intergenic
1145777239 17:27537795-27537817 TGGATATATTCTTTTTAACTGGG - Intronic
1148411688 17:47472629-47472651 TTATTAAATTAATTTTAGCTGGG - Intergenic
1148886560 17:50777541-50777563 TTAATAAATTTTTTTTAGATAGG - Intergenic
1149534634 17:57423299-57423321 TAAGTATATGCTTTTAACCTGGG + Intronic
1149806744 17:59624985-59625007 TTAATATATTTTATTTAACTTGG + Intronic
1149931473 17:60760635-60760657 TTAATATTTTCTCTTTTGCTTGG + Intronic
1151104843 17:71600793-71600815 TTATTATTTTCTTTTTTGGTGGG + Intergenic
1151375322 17:73684533-73684555 TTGATTTATTCTTTGTAGCTAGG + Intergenic
1153393740 18:4593454-4593476 TAAGTATATACTTATTATCTCGG + Intergenic
1155021374 18:21900199-21900221 TAAATATATTATTTTTGGCTGGG + Intergenic
1155408617 18:25517238-25517260 TAAGTATTTTTTTTTTAGCCTGG + Intergenic
1156472455 18:37386050-37386072 TTGGTATATTCTTTTTGCTTTGG + Intronic
1156772249 18:40742677-40742699 GTAGTCTTTTCTTTTTAGTTAGG + Intergenic
1156858294 18:41808446-41808468 ATAGTGTATTATTTTTAGTTTGG - Intergenic
1156935782 18:42705259-42705281 TTGGTTAATTCTTTTTAGCGTGG - Intergenic
1157072655 18:44426932-44426954 TGAGAATATTCTTATTAACTTGG - Intergenic
1158767264 18:60468147-60468169 ATATTATTTTGTTTTTAGCTTGG + Intergenic
1159155713 18:64578961-64578983 TTAGTTTATTCTTTTTGCTTAGG + Intergenic
1159464341 18:68761414-68761436 CTAGTATATTCTGTTTACGTGGG + Intronic
1160089684 18:75814855-75814877 TTAGAATTTTCTTTTTAACTGGG - Intergenic
1160094747 18:75861232-75861254 TTAGGATTTTTTTTTTAACTGGG - Intergenic
1163404596 19:17114219-17114241 TTTGTAGATTCTTTTTTTCTTGG + Intronic
1164175621 19:22771548-22771570 TAAGAAAATGCTTTTTAGCTGGG - Intronic
925035387 2:681077-681099 TCAGAATATTCTGTTTATCTTGG + Intergenic
927773735 2:25885884-25885906 TTAAAATATTATTTTTGGCTGGG - Intergenic
928065473 2:28160292-28160314 TTAGTATATTCTTTTTAGCTGGG + Intronic
929362827 2:41114867-41114889 TTAAAATTTTCTATTTAGCTTGG - Intergenic
930097763 2:47579865-47579887 TTAGAATATTTGTTTTAGCTAGG + Intergenic
930251457 2:49039172-49039194 TCAGTAGATTCTTTTTCTCTGGG + Intronic
930440030 2:51392713-51392735 TTAGAACATGCTGTTTAGCTTGG - Intergenic
932182368 2:69659309-69659331 ATAGCATATTCTTTTCATCTTGG - Intronic
932534394 2:72577277-72577299 ATAGAATATTCTATTTAACTTGG - Intronic
933027981 2:77286461-77286483 TTAGTATATTTTAATCAGCTAGG - Intronic
933107562 2:78351446-78351468 TTAGTAATTTCTTTATACCTAGG - Intergenic
933453890 2:82497175-82497197 ATATTTTATACTTTTTAGCTGGG + Intergenic
935067917 2:99667859-99667881 TTAATATTTTTTTTTTGGCTGGG + Intronic
935433680 2:103004904-103004926 TTAGACTTTTCTTTTTTGCTTGG + Intergenic
935877924 2:107532129-107532151 TTAGTGTTTTCTTTTTTGTTTGG - Intergenic
938660984 2:133487128-133487150 TTTGTATTTTCTTTGTGGCTGGG - Intronic
939554653 2:143659866-143659888 TTAGTCAATGCTTTTTATCTTGG + Intronic
939904280 2:147891418-147891440 TTAGGATGTTGTTTTAAGCTAGG + Intronic
939929286 2:148212769-148212791 TTAGCATATTCATTTTTTCTAGG + Intronic
940484681 2:154282482-154282504 TTAGATTAGTCTTTTTACCTAGG - Intronic
940531090 2:154877138-154877160 TTAATATATTCTTACTAGCATGG - Intergenic
940564362 2:155341333-155341355 TTAATATATTCCTTTTTGCCTGG + Intergenic
941192503 2:162403177-162403199 TTAGTATAATCTTTTTAGTTAGG + Intronic
942011799 2:171770794-171770816 TTTGTATCTTCTTTTTTTCTTGG - Intergenic
942187617 2:173439260-173439282 CTAGAATAGTCTTTTTGGCTGGG + Intergenic
942858845 2:180585485-180585507 TTAGTATCTGCCTTTTAGCAAGG - Intergenic
943146394 2:184051068-184051090 TTTGTATATTTGTCTTAGCTTGG - Intergenic
943360211 2:186910211-186910233 TTACTATATAGTATTTAGCTGGG + Intergenic
945883331 2:215349450-215349472 TTAGCATATGCTTTTTAGAGGGG + Intronic
946549125 2:220780917-220780939 TGAAGATACTCTTTTTAGCTTGG + Intergenic
946586101 2:221189572-221189594 TGAGTTTATTCTTTCTAACTGGG - Intergenic
946661503 2:222005401-222005423 TTTGTATATTTTCTTTAGCGAGG + Intergenic
946791788 2:223308439-223308461 TTAGTGTATTATTTTTAGTTTGG + Intergenic
948241514 2:236440782-236440804 TTAGTAAATTCTGAGTAGCTTGG - Intronic
948678883 2:239618012-239618034 TTATTGTATTATTTTCAGCTTGG + Intergenic
1169392694 20:5203256-5203278 TGAGGATCTACTTTTTAGCTAGG + Intergenic
1170228366 20:14018036-14018058 TGAATATATTCATTTTATCTAGG + Intronic
1171132887 20:22670888-22670910 TAACTTTATTCTTTTTAACTTGG - Intergenic
1172429849 20:34880539-34880561 TTATTATTATTTTTTTAGCTCGG - Intronic
1173527042 20:43740739-43740761 TTAGTGTTTTGTTTTTGGCTTGG - Intergenic
1173698822 20:45048229-45048251 TTAGTATCTTCATTTTAGGTTGG - Intronic
1175344321 20:58261066-58261088 AAAGAATCTTCTTTTTAGCTAGG - Intergenic
1175843241 20:62044079-62044101 TTATTATATGCTTTTTGCCTTGG + Intronic
1177279948 21:18968476-18968498 TTACTATATGCTGTTTAGTTTGG + Intergenic
1177342197 21:19817880-19817902 TTAGCATATTCTTTTTAGTAGGG + Intergenic
1177490277 21:21815506-21815528 TTATAATTTTCTTTATAGCTTGG - Intergenic
1177576376 21:22961821-22961843 GTAATATATTCTTTTTAAGTAGG + Intergenic
1179103296 21:38376080-38376102 TTAGTATTTTCTTTTTAATTGGG + Intergenic
1179461736 21:41539953-41539975 TTAGAATATGCATCTTAGCTGGG + Intergenic
1183057745 22:35317481-35317503 TTAGAATTATCTTTTGAGCTGGG - Intronic
949111645 3:268527-268549 TTATTTTATTTTTTTTAGATGGG - Intronic
951592977 3:24286342-24286364 TTTTTGTACTCTTTTTAGCTTGG + Intronic
951994045 3:28707051-28707073 TTAATATTTTCTTTTTAAATAGG - Intergenic
955629121 3:60953013-60953035 TTAGGGTTTTCTTTTCAGCTGGG - Intronic
956333801 3:68141316-68141338 TGAGTATATTATGTATAGCTGGG - Intronic
956578521 3:70782764-70782786 TTTGTATATTGTTTTAAGATTGG + Intergenic
956826186 3:72998373-72998395 TTAAAATTTTCTTTATAGCTAGG + Intronic
958526009 3:95260335-95260357 TTAATATATTCATTTTTACTTGG - Intergenic
958922897 3:100125992-100126014 TTTGTAAATTTTTTTTAACTTGG - Intronic
959156663 3:102674700-102674722 TTATTATATATTTTTTAGTTGGG + Intergenic
959781061 3:110233924-110233946 TTTGTTTATTATTTTTAACTGGG - Intergenic
960341725 3:116483007-116483029 TTTGTATATTCTTTTTGGGGAGG - Intronic
960749560 3:120932479-120932501 TTAGTATTTTTTGTGTAGCTAGG + Intronic
962099375 3:132325630-132325652 TTAGTATACTCTTTTCCTCTAGG - Intronic
962107874 3:132411574-132411596 TTAGTATGTGCTTTTTATTTTGG + Intergenic
962503327 3:136018443-136018465 TTATAATATTCTTTTTTTCTGGG - Intronic
964147596 3:153484105-153484127 TAAGTTTCTTCTTTCTAGCTTGG - Intergenic
964821828 3:160779398-160779420 TTAGTGTCTTCTTCTTTGCTAGG + Intronic
966184748 3:177217465-177217487 TTAAAATATTATTTTTATCTTGG - Intergenic
966204091 3:177388522-177388544 TTACTATAATCTACTTAGCTTGG + Intergenic
967295018 3:187956102-187956124 CTAGAAAACTCTTTTTAGCTGGG - Intergenic
967709824 3:192693521-192693543 GTACTATATTGTTTTTATCTTGG - Intronic
967719696 3:192802426-192802448 GTAGTATCTTCTGTTTTGCTTGG - Intronic
968382000 4:104390-104412 TTAGAATATTATTTTTAGGAAGG - Intergenic
968396491 4:243342-243364 TTATTATATTCTGTTTATTTAGG - Intergenic
969290783 4:6238365-6238387 TTAGCATATTCATTGAAGCTAGG + Intergenic
970299789 4:14669235-14669257 TTACTGTATACTTTTGAGCTTGG - Intergenic
970943175 4:21659711-21659733 TAAGCATATTCTTTTTATCATGG - Intronic
971033138 4:22662939-22662961 TTTTTTTTTTCTTTTTAGCTTGG - Intergenic
971036776 4:22701998-22702020 TTTGTATATTCTTTTTTTTTTGG + Intergenic
971650788 4:29270561-29270583 TTAGAGTATGCTTTTTAGCCAGG - Intergenic
973118933 4:46493565-46493587 TTAGTATACACTTTGTAGCCAGG + Intergenic
974329505 4:60459176-60459198 TTAGTATAGTATTTTTATATTGG + Intergenic
975015874 4:69418241-69418263 ATAGTATATTCTTTTCCCCTAGG - Intronic
977054357 4:92171658-92171680 TTAGGATTTTCTTTTTTTCTTGG - Intergenic
977275625 4:94974279-94974301 AAAATATATTATTTTTAGCTTGG + Intronic
977299169 4:95248207-95248229 TTAGGATTTTTTTTTTGGCTGGG + Intronic
977613319 4:99059437-99059459 CTCGTATTTTCTTTTTAGCCTGG + Intronic
978714718 4:111827642-111827664 TCTGTATATTTTTTTCAGCTGGG + Intergenic
980101467 4:128545420-128545442 TTTGTATATGCTTTTGGGCTGGG + Intergenic
980339179 4:131520246-131520268 TTATTTTGTTCTTTTTAGTTAGG + Intergenic
980588917 4:134857478-134857500 TTAGTACATTGTTACTAGCTGGG - Intergenic
982684363 4:158470289-158470311 CAAGTTTATTCTCTTTAGCTGGG - Intronic
983090789 4:163499262-163499284 TTTGTAGTTTGTTTTTAGCTTGG + Intronic
984109878 4:175599700-175599722 TTAGCATATTTGTTGTAGCTTGG + Intergenic
986490954 5:8289613-8289635 GTAGTAAACTCATTTTAGCTTGG - Intergenic
987506849 5:18784546-18784568 TTAGGAAATTCTTTTTTACTGGG + Intergenic
987666970 5:20955493-20955515 TTTGTATATTCTGTAGAGCTGGG - Intergenic
988027115 5:25709618-25709640 TTTGAATATTCTTTTTTTCTAGG + Intergenic
988106921 5:26762429-26762451 TTTGTGTATTGTTTTTTGCTGGG - Intergenic
988870390 5:35383728-35383750 TTAGCATATTCTTTCTTCCTTGG + Intergenic
989548745 5:42706828-42706850 TGGGTTTATTCTTTTTAGTTAGG + Intronic
990120525 5:52445215-52445237 ATAGTATATTCATTTTTTCTTGG - Intergenic
990272071 5:54153067-54153089 TAAGTATTTTATTTTTAGGTTGG - Intronic
991402294 5:66264469-66264491 TTACTACATTGTTTTTAGTTTGG + Intergenic
992560477 5:77947568-77947590 TTAATATTTTCTTTTTGCCTTGG - Intergenic
993300040 5:86197068-86197090 TTACTATATTATTTATAGTTGGG + Intergenic
993362023 5:86989270-86989292 TTATTATATTAGTTTTATCTAGG - Intergenic
993725099 5:91357917-91357939 TTTGTCTATTTTTTTTAGTTGGG - Intergenic
993956321 5:94237790-94237812 CTAGTTTATTCTGTTTTGCTAGG - Intronic
994489956 5:100428441-100428463 TTAGGATATTATCTTTACCTGGG - Intergenic
994490473 5:100436729-100436751 TGAGAATATTTTTATTAGCTAGG + Intergenic
994511729 5:100712109-100712131 TCAGTATATGCATTTTAGATGGG - Intergenic
995806868 5:116063075-116063097 TTTGTATATTCTTTTTAAGTTGG + Intergenic
996116499 5:119625871-119625893 TTAAAATATTCATTCTAGCTGGG - Intronic
996324485 5:122257670-122257692 TTAGAATTTTCTTTTTTGTTAGG + Intergenic
996606337 5:125327941-125327963 TGACTATATTCTTCTTAGCCTGG - Intergenic
996659232 5:125980223-125980245 TTTGTATATCCTTTTGATCTGGG - Intergenic
996731636 5:126722880-126722902 TTATTATATATTTTTTAGATGGG - Intergenic
997124617 5:131213187-131213209 TTATTATATTTTTTTGAGATGGG - Intergenic
998578733 5:143347188-143347210 TTAGTCTCTACTTTTTAGTTTGG - Intronic
998586572 5:143433263-143433285 TTAACATATTCTTTTGAGCTAGG + Intronic
998865975 5:146502600-146502622 TTGGTATAATGTTTTTAACTTGG + Intronic
999856232 5:155597237-155597259 TGAGTATATACCCTTTAGCTTGG + Intergenic
1000198316 5:158982700-158982722 TTATTAAATTATATTTAGCTAGG - Intronic
1000205882 5:159058211-159058233 TTTAGATATTCTTTTTAGTTTGG - Intronic
1000714405 5:164622884-164622906 TTAGTAAATTCTTCTTACCCTGG + Intergenic
1000956216 5:167546782-167546804 TTAGTTTAGTCTTTTGAGCATGG - Intronic
1001439476 5:171729702-171729724 TTTGTATTTTCTTTTTTTCTTGG - Intergenic
1006994789 6:38248982-38249004 TTAGGATATTCTCTTCACCTCGG - Intronic
1007330266 6:41101335-41101357 TGAGTATCTTCGTTTTAGCGTGG + Intergenic
1008372407 6:50747820-50747842 GTAGTATTTTCCTTTTACCTGGG + Intronic
1009381144 6:63031689-63031711 TTAGTATTTTCTTTTTTGAATGG + Intergenic
1010355926 6:74933085-74933107 TTAGTTTATTTTTTTTAGGGGGG - Intergenic
1010942933 6:81940389-81940411 TTATTATACTCTTTTAAGATTGG - Intergenic
1011193307 6:84756892-84756914 TCAGTATACTGTTTTTATCTTGG + Intronic
1011245065 6:85313916-85313938 TTAGTACATGCTCTTTAGCTCGG + Intergenic
1011358877 6:86500919-86500941 TTAGGAAATTCTTTTTTACTGGG + Intergenic
1011783965 6:90823273-90823295 TTAGCATTTTTTTTTTTGCTTGG + Intergenic
1012425694 6:99112117-99112139 TTATCTTATTCTTTTCAGCTTGG + Intergenic
1012724811 6:102797239-102797261 TTAATCTATCCTTTTTATCTGGG - Intergenic
1015098863 6:129450687-129450709 TTAATAAATGCTTTATAGCTTGG - Intronic
1015175364 6:130301335-130301357 TAAGTATTTTCTTTTTTGTTTGG - Intronic
1015262527 6:131254842-131254864 TTAGTATAGTCTTTTTGTGTGGG + Intronic
1015665483 6:135623579-135623601 ATAGAATATTTTCTTTAGCTGGG - Intergenic
1016499496 6:144703479-144703501 TTAGAATATTTTTTTTCCCTTGG - Intronic
1017238125 6:152138608-152138630 TTAGTATATGCTTTTTATTTGGG - Intronic
1017978656 6:159379363-159379385 TTAGACTATTCTCTTTTGCTTGG - Intergenic
1018115322 6:160578220-160578242 TTAGAATATCCATTTTGGCTAGG + Intronic
1018148129 6:160912521-160912543 TTAGAATATCCATTTTGGCTAGG - Intergenic
1020019549 7:4854820-4854842 CTAGTGCATTCTTTTTAGGTTGG - Intronic
1020430262 7:8111117-8111139 TTTGTATATTCTTTAAATCTTGG + Intergenic
1020597548 7:10227537-10227559 TTATTATTTTGTTTTTAGCTGGG - Intergenic
1020709420 7:11588069-11588091 TGAGTGTCTTCTTATTAGCTGGG + Intronic
1020851661 7:13361282-13361304 TTTGAATTTTCCTTTTAGCTGGG - Intergenic
1020875908 7:13693281-13693303 TTTTTAAATTCTTTTTTGCTTGG - Intergenic
1021290963 7:18845109-18845131 TTAATATATACTATTTAGTTTGG + Intronic
1023322662 7:39015088-39015110 TTAGAATATTCTGTTTTGTTCGG + Intronic
1026289460 7:68993270-68993292 TTAAAACATTCTTTGTAGCTGGG + Intergenic
1027153988 7:75753460-75753482 TTAGAATTTTATTTTTAGGTCGG - Intergenic
1027949892 7:84802019-84802041 TTAGAATAATCTTTTCAGTTAGG + Intergenic
1028622338 7:92837297-92837319 TTAGTATTTTCTTTTCTGCAAGG - Intergenic
1028635512 7:92984897-92984919 TTAAGATATACTTCTTAGCTAGG + Intergenic
1030104118 7:105972303-105972325 TTAGTCTATTCGTTTGGGCTAGG + Intronic
1030266181 7:107624563-107624585 TTAGATTATTGTTTTTAGATGGG - Intronic
1030292138 7:107883409-107883431 TTGTTATATTATTTTTAACTGGG - Intergenic
1030753116 7:113257226-113257248 ATAATATATACTTTTTACCTCGG - Intergenic
1032253716 7:130280249-130280271 TTTGCACATTCTTTTTAGCTGGG - Intronic
1032314678 7:130824611-130824633 TTATTATATTTTTATTAGGTGGG + Intergenic
1033112075 7:138588831-138588853 TTTGTATATTCTGTTGAGGTGGG - Exonic
1033811990 7:145025345-145025367 TTGATATATACTTATTAGCTTGG - Intergenic
1035105493 7:156438991-156439013 TTATTTTATTTTTTTTAGATGGG - Intergenic
1035927970 8:3749588-3749610 ATAATATATTCTTTTTAACTTGG - Intronic
1036622009 8:10430436-10430458 TTAGTTTATTCTATTTAATTGGG + Intergenic
1037116296 8:15232310-15232332 TTAAAATATTCTTTTTTACTGGG + Intronic
1037188782 8:16097361-16097383 CTAGTATATTCTTGTTGACTTGG - Intergenic
1037302540 8:17467970-17467992 TTACTGTATTTTTTATAGCTAGG + Intergenic
1038320596 8:26522672-26522694 TTTGTACATTTTTTTTAGCTGGG + Intronic
1038352677 8:26793031-26793053 TCAGTTTATTTTTTTTACCTAGG - Intronic
1038662358 8:29508121-29508143 TTAGAATATTCTTTGAAACTGGG + Intergenic
1040914082 8:52551239-52551261 TCAGGATATTCTTTGTAGGTGGG - Intronic
1041436118 8:57843715-57843737 TTAGTATAATCTTATAATCTGGG - Intergenic
1042570994 8:70164642-70164664 TTAGGATATAGTTTTTAACTTGG + Intronic
1044367865 8:91371076-91371098 TAACTATGTTCTTTTTAGCATGG + Intronic
1045188938 8:99864653-99864675 TTAATATATTTTTATTAACTGGG - Intronic
1045382229 8:101638720-101638742 TTAGACTGTTCTTTTTATCTTGG + Intronic
1045753698 8:105516219-105516241 TCAGTTTATTCTTTTTGGCTGGG - Intronic
1046737391 8:117791491-117791513 TTAGTATATTTATTTTTGGTTGG - Intergenic
1046804643 8:118466433-118466455 TTAGTATATTCATTTTACATAGG + Intronic
1046841857 8:118867964-118867986 TTTGCAGATTCTTCTTAGCTGGG + Intergenic
1048661889 8:136613714-136613736 TTTATATTTTCTTTTTTGCTTGG - Intergenic
1048786849 8:138059715-138059737 TTAGTATCTTATATTTAACTAGG + Intergenic
1049314528 8:141956072-141956094 TTAGGATTTTCTCTTTAACTGGG - Intergenic
1050724268 9:8629023-8629045 TTAGTAGATTATTTTTAGACTGG - Intronic
1052038825 9:23714800-23714822 TCAGTATTTTTTTTTTAACTGGG - Intronic
1052135990 9:24910751-24910773 TTTGAATATTCTTTTGGGCTAGG - Intergenic
1052755348 9:32535364-32535386 TTTATTTATTCTTTTTAGTTGGG - Intergenic
1054897100 9:70326611-70326633 TTAATTTTTTTTTTTTAGCTGGG + Intronic
1055898276 9:81205192-81205214 AAAGTCTATTTTTTTTAGCTTGG + Intergenic
1056042559 9:82683218-82683240 CTCGTATCTTCTTTTTACCTAGG + Intergenic
1056247923 9:84716518-84716540 ATAGCATATTCTTTTAATCTGGG - Intronic
1056707353 9:88963019-88963041 TTAGGATTTTATTTTTGGCTAGG - Intergenic
1056925174 9:90828360-90828382 TTACTATATTGCTTTTATCTGGG - Intronic
1057545106 9:96013690-96013712 TAAGTATTTTCTTTTTCCCTGGG + Intronic
1058965023 9:110029266-110029288 CTAGGATCTTCTTTTTAGTTGGG + Intronic
1187908688 X:24090452-24090474 TTATTTTATTTTTTTTAGATAGG + Intergenic
1188174226 X:26968105-26968127 TTAATATGTTCTTTCTGGCTAGG - Intergenic
1188412241 X:29887668-29887690 TTTGTAAATTGTTTTGAGCTAGG + Intronic
1188616882 X:32168249-32168271 CTAGTATCTTCATTCTAGCTTGG - Intronic
1189048938 X:37623066-37623088 TTTGTTTTTTGTTTTTAGCTAGG + Intronic
1192008709 X:67244428-67244450 CTTGTATATTCTTTTTATTTAGG - Intergenic
1192227649 X:69240446-69240468 TTTGTATAATCCTTTTAGCAAGG + Intergenic
1192296398 X:69853635-69853657 TAAGTATAATCTTTTTTGCCTGG - Intronic
1192415015 X:70971780-70971802 TTAATATATTGTTTTAGGCTGGG - Intergenic
1192611899 X:72575080-72575102 GTAGTCTATTCTCTTTAGCCTGG - Intergenic
1192970730 X:76226523-76226545 TTGGAATATACTTTTTTGCTAGG + Intergenic
1194562420 X:95438898-95438920 TTATTTTATTATTCTTAGCTTGG - Intergenic
1195808017 X:108797371-108797393 TTGGTAAATTTTTTTTAGCCAGG + Intergenic
1196009134 X:110867626-110867648 GTAGTGTATTCGGTTTAGCTGGG + Intergenic
1197121695 X:122900547-122900569 TTTGTATATTCTATTTCACTAGG - Intergenic
1198108929 X:133485565-133485587 TTAGCATATTCTTTTCAGTTTGG - Intergenic
1198764218 X:140064515-140064537 TTAGTACCTTCTTTTCAGCCTGG - Intergenic
1199152798 X:144507465-144507487 TTAGTGTATTATTTTTTTCTTGG + Intergenic
1200361760 X:155613795-155613817 TTTGTATATTTTTTTTCCCTAGG + Intronic
1201401564 Y:13609344-13609366 TTAGGAAATTCTTTTTTTCTGGG - Intergenic
1201523417 Y:14903006-14903028 TTACTAAATTCTTTTTATTTGGG + Intergenic
1202580264 Y:26373254-26373276 ATAGAAAATACTTTTTAGCTGGG + Intergenic