ID: 928065474

View in Genome Browser
Species Human (GRCh38)
Location 2:28160303-28160325
Sequence TTTTTAGCTGGGCCCGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065466_928065474 24 Left 928065466 2:28160256-28160278 CCAGGACTAGCCACTGCGCCTGG 0: 1
1: 0
2: 1
3: 40
4: 349
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065470_928065474 6 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065468_928065474 14 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065471_928065474 1 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065474 Original CRISPR TTTTTAGCTGGGCCCGTGCA TGG Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
901689212 1:10961482-10961504 TTCTGAGCTGGGCTGGTGCAGGG + Intronic
910392640 1:86760724-86760746 TTTCTAGCTGGATCCTTGCATGG - Intergenic
911993854 1:104737401-104737423 TTTCCAGCTGGGCCTGGGCATGG + Intergenic
914972703 1:152325264-152325286 TTTATAGCAGGCCCCATGCAGGG + Intergenic
915269813 1:154746047-154746069 TTTTTCACTAGTCCCGTGCAAGG - Intronic
917307073 1:173638019-173638041 TTCCTACCTTGGCCCGTGCATGG - Intronic
921949564 1:220915366-220915388 TTTTGAGCTAGGCATGTGCAGGG + Intergenic
1063870536 10:10412238-10412260 TTTTCAGCTGGGTCCCTCCATGG + Intergenic
1069602477 10:69716912-69716934 CCTTTGGCTGGGACCGTGCAGGG - Intergenic
1069985567 10:72280639-72280661 TTCTCAGCTGGGCCCCTGCATGG - Intergenic
1070397772 10:76026629-76026651 CTTCTAGCTGGGACTGTGCAAGG - Intronic
1084764851 11:71301600-71301622 TTCCCAGCTGGGCCCCTGCAGGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090610571 11:128467171-128467193 TTCCTGGCTGGGCCCGTGGATGG + Intronic
1095516263 12:43009215-43009237 TTTTTAGCTCTGCCTGTTCAAGG - Intergenic
1096331341 12:50715798-50715820 TTTTTAGCTGGACACATGCCTGG - Intronic
1096547549 12:52351034-52351056 TTTCTAGCTGGGTCCCTTCAGGG + Intergenic
1097595637 12:61626065-61626087 TTTTTATCTGGGCTCTTGCTGGG - Intergenic
1100963606 12:99989328-99989350 TTTTCAGCTGGCCAGGTGCAGGG - Intergenic
1102159593 12:110757700-110757722 TTTGTGCCTGGGCCCGTGCCTGG + Intergenic
1104951952 12:132445167-132445189 TGTTTGGCTGGGCCCGGGCCAGG - Intergenic
1106308916 13:28535596-28535618 TTTTTTCCTGGGCCTGTCCATGG + Intergenic
1107411519 13:40162642-40162664 CTTTTTGCTGGGCCCTTACATGG - Intergenic
1107881628 13:44837146-44837168 TTTCTAGCTGTGTCCCTGCATGG + Intergenic
1121648410 14:95536409-95536431 TTTTTAGCTAGGGACATGCAGGG - Intronic
1130084021 15:80762172-80762194 TTTTTAGGTGTGCCAGTTCAGGG + Intergenic
1134888662 16:17818707-17818729 ATTATAGCTGGGCCCCTCCATGG - Intergenic
1142884785 17:2905769-2905791 TTCTGAGCTGGGCCTGTTCACGG + Intronic
1143324750 17:6091513-6091535 CTTTGAGCTGGGCCCCTTCAGGG - Intronic
1147044680 17:37743976-37743998 TTGTTAGCCGCGCCCATGCAAGG - Intronic
1162304574 19:9864090-9864112 TTTTCTGCTGGCCCCATGCAAGG - Intronic
925429529 2:3779178-3779200 CTTTTAGCTGGGAACGTCCAGGG + Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
931340808 2:61399041-61399063 TTTTTAGCTGTGCCCATGTTAGG - Intronic
937829401 2:126403258-126403280 TTTGTAGCAGGGCCTGGGCATGG + Intergenic
942150193 2:173068492-173068514 ATTGGAGCTGGGCCCATGCACGG + Intergenic
1170598523 20:17823316-17823338 TGTTTAGATGGGCCCCAGCATGG - Intergenic
1171804353 20:29662031-29662053 CTTTTTCCTGGGCCCGTCCATGG - Intergenic
1172904553 20:38359288-38359310 CTTATAGCTGGGGCCGGGCATGG + Intronic
1173249960 20:41359098-41359120 TTGTCATCTGGGCCCTTGCAGGG + Exonic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1181582644 22:23836750-23836772 TATTCAGGTGGGCCCTTGCATGG + Intronic
1184779535 22:46640062-46640084 TGTCCAGCTGGGCCTGTGCATGG + Intronic
956203104 3:66728101-66728123 ATATTAGCTGGGCAAGTGCAAGG - Intergenic
959750961 3:109834476-109834498 ATTTTATCTTGGCCAGTGCATGG - Intergenic
959944328 3:112111409-112111431 GTTCTAGCTGGGCCAGTCCAGGG - Intronic
965409209 3:168308542-168308564 TTCCTAGCAGGGTCCGTGCATGG + Intergenic
967554476 3:190838395-190838417 TTATTACCTCGGCCAGTGCAGGG + Intergenic
968168592 3:196489615-196489637 TTTTTAACTGGAGCCGGGCACGG - Intronic
968986473 4:3878048-3878070 TTTTTACCTTGGCCCATCCAAGG - Intergenic
988906194 5:35792839-35792861 ATTATAGCTGTGCCTGTGCAAGG - Intronic
990010082 5:50987108-50987130 TATTTATCTGTGCCCATGCAAGG + Intergenic
991534202 5:67648725-67648747 CTTTTAGCTGGGTCCCTGCATGG + Intergenic
996409953 5:123147470-123147492 TTTGTAGCAGGGCCTGTGGATGG + Intronic
1016038939 6:139411947-139411969 TCTCTTGCTGGGCCCTTGCAGGG + Intergenic
1017519408 6:155188223-155188245 TTTATTGCTGGGCCCGTGCTTGG + Intronic
1018291624 6:162297843-162297865 TTTTTAGCTAGGACTGGGCATGG - Intronic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1026004478 7:66590353-66590375 TTTTTAGCTGGGTCCTTTTATGG - Intergenic
1026013802 7:66656500-66656522 TTTTTAGCTGGGTCCCTGTGTGG + Intronic
1026025860 7:66742988-66743010 TTTTTAGCTGGGTCCTTGTGTGG + Intronic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1047423404 8:124726117-124726139 TTTTTAACTGGAACCATGCAGGG + Intronic
1047675476 8:127197024-127197046 TTGTTAGCTGGGCCCCTGGGAGG + Intergenic
1050380566 9:5023964-5023986 TTTTTAGCTTGGGCCGGGCACGG + Intronic
1050590285 9:7153564-7153586 TTTGCAGCTGGGCCTTTGCATGG + Intergenic
1051919608 9:22249976-22249998 TTTTTAGCTGTGTCCTTGCCAGG + Intergenic
1061557457 9:131380285-131380307 TCTTAAGCTGGGCACGGGCACGG + Intergenic
1190318779 X:49167164-49167186 TTTTTAGCCCGGCCCGTCCAGGG - Intronic