ID: 928065474

View in Genome Browser
Species Human (GRCh38)
Location 2:28160303-28160325
Sequence TTTTTAGCTGGGCCCGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065470_928065474 6 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065471_928065474 1 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065468_928065474 14 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65
928065466_928065474 24 Left 928065466 2:28160256-28160278 CCAGGACTAGCCACTGCGCCTGG 0: 1
1: 0
2: 1
3: 40
4: 349
Right 928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG 0: 1
1: 0
2: 1
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065474 Original CRISPR TTTTTAGCTGGGCCCGTGCA TGG Intronic