ID: 928065477

View in Genome Browser
Species Human (GRCh38)
Location 2:28160317-28160339
Sequence CGTGCATGGAGCTTAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065470_928065477 20 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065468_928065477 28 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065471_928065477 15 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065477 Original CRISPR CGTGCATGGAGCTTAGTGTA TGG Intronic
900081279 1:860101-860123 CCTGCATGGAGCATTTTGTATGG - Intergenic
904495995 1:30887074-30887096 TGTGCAGGGAGCTGAGTGTGAGG - Intronic
904580353 1:31538880-31538902 CCTGCATGGAGCTTGGTGTCTGG - Intergenic
906648503 1:47493267-47493289 CCTGCATGGAGCTTAGGTCAAGG - Intergenic
909085573 1:71166355-71166377 TTTGCATGGAGCTTGGTGCATGG + Intergenic
912736455 1:112153336-112153358 CTGGAATGGAGCTTAGTGCAAGG + Intergenic
912795655 1:112691925-112691947 CTTGAATGGTGCTTGGTGTATGG - Intronic
920385502 1:205568380-205568402 CTTCCAGGGAGCTTAGTGTGAGG + Intergenic
1069332013 10:67303894-67303916 GGTGAATGGAGCTTAGATTATGG - Intronic
1076181292 10:128410806-128410828 CCTGCATGGAGCTTAGATGACGG + Intergenic
1076870428 10:133190239-133190261 AGTGCAGGGTGCTTAGTGTAGGG - Intronic
1076870443 10:133190341-133190363 AGTGCAGGGTGCTTAGTGCAGGG - Intronic
1077552390 11:3206441-3206463 GGTGCATGGAGGGTGGTGTAGGG + Intergenic
1091916008 12:4272285-4272307 CTTGCAGGGAACCTAGTGTACGG + Intergenic
1094394463 12:29991205-29991227 CCAGCATGTAGCTTAGTGTTTGG - Intergenic
1098841397 12:75482547-75482569 CGTGCGTGGTGCCTAGTGCATGG - Intronic
1102564162 12:113783676-113783698 CGAGCATGTAGCGTAGTGTCTGG - Intergenic
1104603580 12:130170695-130170717 CGTGCAGGCAGCATAGTGTGGGG + Intergenic
1106769179 13:32945145-32945167 GGTGGCTGGAGCTTAGTGTGTGG + Intergenic
1108968206 13:56339211-56339233 TGTGCATGGATCCTAGTGAAAGG + Intergenic
1118494548 14:66295304-66295326 CAAGCATGGAGCTTAATGTTGGG + Intergenic
1119496252 14:75082075-75082097 TGTGCATGGACCTTAGTCTCTGG - Exonic
1120680985 14:87480444-87480466 GGTGCTTGGAATTTAGTGTAGGG + Intergenic
1122821113 14:104345656-104345678 TGTGCATGGAGCTTAGGGCCAGG + Intergenic
1123180301 14:106463206-106463228 CCTGCAGGGAGATTTGTGTATGG + Intergenic
1202946598 14_KI270726v1_random:33447-33469 CCTGCAGGGAGATTTGTGTATGG - Intergenic
1128469212 15:67937896-67937918 TGAGAATGGAGCTTGGTGTATGG - Intergenic
1128657435 15:69472746-69472768 TGTGGATGGAACTGAGTGTAAGG + Intergenic
1130890798 15:88132443-88132465 CTAGCATGGGGCTTAGTGCAAGG - Intronic
1135101967 16:19613762-19613784 CTTGCATGGAGCTCAGGGTGAGG + Intronic
1135771238 16:25220075-25220097 CGTGCATGGAGCTTATCTGAGGG + Intronic
1137669037 16:50268684-50268706 AGGGCATGGAGGTTGGTGTAGGG + Intronic
1144649916 17:17000911-17000933 CCTGCATGGAGCTTACTGTCTGG - Intergenic
1144769166 17:17749760-17749782 CTTTCATGGAGCTTACAGTATGG - Intronic
1146334130 17:31954565-31954587 CCTTTATGGAGCTTAGTGTTAGG + Intronic
1149952695 17:61007620-61007642 CCTGCATGGAGCTTTGCCTAGGG - Intronic
1151668289 17:75557999-75558021 CATGCATGGAGCCTAGGGTGGGG - Intronic
1167980643 19:53272472-53272494 CGTGCAAGGAGCTAAGCATATGG + Intergenic
1167985544 19:53311744-53311766 CGTGCAAGGAGCTAAGCATATGG - Intergenic
927279680 2:21293368-21293390 CCTCCACGGAGCCTAGTGTATGG + Intergenic
928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG + Intronic
934489179 2:94747061-94747083 CTGGCATAGAGCTTATTGTAGGG - Intergenic
934669720 2:96203503-96203525 TCAGCATGGAGCTTGGTGTAAGG + Intronic
935357028 2:102210826-102210848 TGGGCATGGAGCTTAGAGGAAGG + Intronic
945152092 2:206802577-206802599 CATGCATGGGGCCCAGTGTATGG + Intergenic
1174115100 20:48221360-48221382 CTTGCATGGAGCTGGGTGTGGGG + Intergenic
1175523089 20:59615374-59615396 TGTGCATGGAGCATGGTGTGAGG + Intronic
1178192597 21:30302155-30302177 ACTGCATGAAGCTTAGTGTAGGG - Intergenic
1179185159 21:39080033-39080055 CGTGCAGTGTGCATAGTGTATGG + Intergenic
952816970 3:37454053-37454075 CGTGCCTGGTGCCTAGTGTGGGG - Intronic
956469524 3:69551888-69551910 TGTGTATGGAGCTTATTTTATGG - Intergenic
961110332 3:124278142-124278164 CTTGGATGGAGGATAGTGTAGGG + Intronic
961357276 3:126347027-126347049 CCTGCATGGAGTTGAGTGTTGGG + Intronic
963843002 3:150127177-150127199 CGGGCATGGTGCTGAGTGTAAGG + Intergenic
968233084 3:197015707-197015729 CGTGCATGTAACTCAGTGTGTGG + Intronic
984205312 4:176780411-176780433 CGTGCTTAGTGCTTAGTGAATGG - Intronic
990734013 5:58840555-58840577 CGTGCATAGAAATCAGTGTAGGG - Intronic
991506941 5:67335183-67335205 AGTGAATGGAACTTAGTATATGG + Intergenic
1002780533 6:361764-361786 AGTGCATGGATCTGAGTGAAAGG - Intergenic
1006790372 6:36697472-36697494 CGTGGCTGAAGCTAAGTGTATGG - Intergenic
1008577681 6:52876860-52876882 CATGCATGGAGCTTCTTGGAGGG - Intronic
1009445653 6:63739241-63739263 CTGGGATGGAACTTAGTGTATGG + Intronic
1018955925 6:168410661-168410683 CGTGCACGGAGCCTGGTGAAAGG + Intergenic
1022940085 7:35227391-35227413 CGTGAATGGAGCTTAAGGTCTGG - Intronic
1024251902 7:47511952-47511974 AGTACATGGAGCTTCGTGGAAGG - Intronic
1024658924 7:51474988-51475010 GGTGCATGGTGATCAGTGTAGGG - Intergenic
1025216916 7:57064325-57064347 CCTGTATGGAGGTTAGTGGATGG - Intergenic
1025654469 7:63506423-63506445 CCTGTATGGAGGTTAGTGTATGG + Intergenic
1035523985 8:297360-297382 CCTGCATGGAGCATTTTGTATGG + Intergenic
1040360917 8:46663686-46663708 CTTGCATGGATTTTTGTGTATGG + Intergenic
1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG + Intronic
1186365462 X:8888028-8888050 CTTGCATGGAACTTTCTGTAAGG + Intergenic
1194980312 X:100433612-100433634 CAAGCATGGTGCTTAGTGTTAGG - Intergenic
1197968350 X:132089321-132089343 CTTGCATGGAGTATAGTGTGAGG - Intronic