ID: 928065477

View in Genome Browser
Species Human (GRCh38)
Location 2:28160317-28160339
Sequence CGTGCATGGAGCTTAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065471_928065477 15 Left 928065471 2:28160279-28160301 CCATGATTGGTTTTTAGTATATT 0: 1
1: 0
2: 2
3: 34
4: 428
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065468_928065477 28 Left 928065468 2:28160266-28160288 CCACTGCGCCTGGCCATGATTGG 0: 2
1: 3
2: 102
3: 845
4: 4748
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67
928065470_928065477 20 Left 928065470 2:28160274-28160296 CCTGGCCATGATTGGTTTTTAGT 0: 1
1: 0
2: 3
3: 50
4: 425
Right 928065477 2:28160317-28160339 CGTGCATGGAGCTTAGTGTATGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065477 Original CRISPR CGTGCATGGAGCTTAGTGTA TGG Intronic