ID: 928065685

View in Genome Browser
Species Human (GRCh38)
Location 2:28162248-28162270
Sequence GCCCTTTGTCTTTACTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065685_928065686 -6 Left 928065685 2:28162248-28162270 CCGGGACAGTAAAGACAAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 181
Right 928065686 2:28162265-28162287 AAGGGCACCTGAAATGTACATGG 0: 1
1: 0
2: 1
3: 15
4: 148
928065685_928065688 5 Left 928065685 2:28162248-28162270 CCGGGACAGTAAAGACAAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 181
Right 928065688 2:28162276-28162298 AAATGTACATGGCTCTCTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065685 Original CRISPR GCCCTTTGTCTTTACTGTCC CGG (reversed) Intronic