ID: 928065809

View in Genome Browser
Species Human (GRCh38)
Location 2:28163470-28163492
Sequence GAAAATGTACACATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928065804_928065809 24 Left 928065804 2:28163423-28163445 CCTAAGGGGAGAAAAAGAACATT 0: 1
1: 1
2: 3
3: 54
4: 574
Right 928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928065809 Original CRISPR GAAAATGTACACATGGTGCT GGG Intronic
900510747 1:3059643-3059665 AAAAATCCACACATGATGCTGGG + Intergenic
901109407 1:6783950-6783972 GAAAAAGAACACATGTTGTTAGG + Intergenic
905003363 1:34691067-34691089 TAAAATGGACACATTGGGCTGGG + Intergenic
906039267 1:42774934-42774956 GAAAATGTAGACATGTGGATTGG + Intronic
906923229 1:50087074-50087096 GAAAATGAACCCATGGTTCAAGG + Intronic
907871707 1:58449492-58449514 GAAAATTTACATTTGGTGGTTGG - Intronic
910682912 1:89885721-89885743 GAGAATAAACACATTGTGCTTGG + Intronic
911455843 1:98122567-98122589 AAATATGTATACATAGTGCTTGG + Intergenic
911850217 1:102808469-102808491 AAAAATTTACTCATGGTACTTGG + Intergenic
913300201 1:117362195-117362217 GATTATGTATACATGTTGCTAGG - Intergenic
913696548 1:121331809-121331831 CAGAATGTACTCATTGTGCTTGG - Intronic
914141013 1:144948252-144948274 CAGAATGTACTCATTGTGCTTGG + Intronic
915880575 1:159667107-159667129 GAACATGTGCACAAGGTGGTCGG + Intergenic
916226774 1:162496936-162496958 GAACATGTACCCAAGGTGGTTGG + Intergenic
917014409 1:170513127-170513149 AGAAATGTATACATTGTGCTAGG + Intergenic
917259475 1:173151155-173151177 GAAAATGTAATCATGGAGATGGG - Intergenic
917697868 1:177546622-177546644 GAAAATATACCCAAAGTGCTGGG + Intergenic
917903154 1:179563882-179563904 GAAACAGTACACCTGCTGCTGGG - Intronic
918053222 1:180993175-180993197 GGAAATGTTGACAGGGTGCTGGG + Intronic
919078309 1:192839091-192839113 GAATATGTACCCAAGGTGGTCGG + Intergenic
920483876 1:206350162-206350184 CAGAATGTACTCATTGTGCTTGG - Intronic
921501782 1:215913297-215913319 TAAAATGTACACAAAGTGCTAGG + Intronic
921870336 1:220132819-220132841 GAAAAAGGAGACATGGGGCTGGG - Intronic
923189021 1:231602273-231602295 CAAAATGTAAACATTGTGTTTGG + Intronic
923328719 1:232902874-232902896 GAACATGTACCCAAGGTGGTTGG + Intergenic
924583872 1:245345056-245345078 GAAAATTTACCCTTGCTGCTGGG - Intronic
1062828676 10:590251-590273 GAAAATGAGTACATGGTGCAAGG + Intronic
1063531323 10:6833898-6833920 GAAAAAGTACACATTTTGTTTGG - Intergenic
1063731714 10:8705046-8705068 GAAAATGTATGCAAGGTGCTTGG + Intergenic
1065294966 10:24265621-24265643 GAAAATGTCCACATGAAGATGGG - Intronic
1065766561 10:29035645-29035667 GTGAATGTACAAATGGTACTTGG + Intergenic
1067700710 10:48569350-48569372 GGAAATGTACCCATCGTCCTCGG + Intronic
1067719567 10:48717484-48717506 GAATGTGTACACAGGGAGCTTGG - Intronic
1069585681 10:69599931-69599953 GAACATGTACCCAAGGTGGTGGG - Intergenic
1071032150 10:81197462-81197484 GAACATGTACCCAAGGTGGTTGG - Intergenic
1071074017 10:81730058-81730080 GAAAATGTGCCCAAGGTGGTTGG + Intergenic
1071379622 10:85045071-85045093 GTAAAAGTACACGTGGTGCTGGG + Intergenic
1071863110 10:89696190-89696212 GAACATGTGCACAAGGTGGTTGG - Intergenic
1073191792 10:101656550-101656572 GAAAATGTACACATTGGTCCTGG - Intronic
1074334610 10:112558628-112558650 GTAAAAGTTCACTTGGTGCTGGG + Intronic
1074433336 10:113412313-113412335 GAAAATGTGGACATGTTCCTAGG + Intergenic
1074438922 10:113457960-113457982 GAACATGTACAATTGGTGCCAGG - Intergenic
1075511961 10:123079749-123079771 CAAACTGTACAAATGGTGGTTGG - Intergenic
1075884511 10:125886354-125886376 GAAAATGTATACATTATGTTAGG - Intronic
1076223741 10:128756840-128756862 TAAAATGTACACATTTTGGTGGG + Intergenic
1076257341 10:129038158-129038180 AATAATGTACACAAGGAGCTTGG + Intergenic
1076544967 10:131239020-131239042 GAAAATGCACACGTGCTACTTGG - Intronic
1078548031 11:12260338-12260360 GAACATCTACTCACGGTGCTAGG + Intronic
1078603013 11:12749891-12749913 CAAAATGTAAACCTGGTCCTTGG - Intronic
1079920158 11:26423625-26423647 AAAAATGAACACGTTGTGCTTGG - Intronic
1081780913 11:45711744-45711766 GAAAATGTGCACAGGATGATAGG + Intergenic
1081975444 11:47231669-47231691 AAAAATTTAGACATGGTGGTAGG - Intronic
1082934163 11:58639211-58639233 GACCATGTGCACATGGTGCCAGG - Intergenic
1083084042 11:60124222-60124244 GTAAATAGACACTTGGTGCTAGG - Intergenic
1085213753 11:74808617-74808639 GATAATATAGACATAGTGCTTGG + Intronic
1087812951 11:102628242-102628264 AAAAATGTACATAAGGTACTTGG - Intergenic
1088168073 11:106962254-106962276 GAAAATGTGTATATGGGGCTGGG + Intronic
1088393520 11:109342128-109342150 GAAAATTGATACATGGTGCTGGG + Intergenic
1088967041 11:114733885-114733907 GAAAATATACACATGGGACTGGG - Intergenic
1089439047 11:118499399-118499421 GAAAATATCCACATGATGATTGG + Exonic
1089460571 11:118650686-118650708 GAAAATGTACACAATGTACCTGG + Intronic
1090949888 11:131464215-131464237 GAAAGTTTCCATATGGTGCTTGG - Intronic
1091333496 11:134749574-134749596 TAAAATGTACAAATGGTCCTGGG - Intergenic
1093762386 12:22924865-22924887 GAACATGTACCCAAGGTGGTTGG - Intergenic
1095314636 12:40745306-40745328 GAACATGTGCCCAAGGTGCTCGG + Intronic
1096177342 12:49531309-49531331 GAAAATGTAAACCTGGTGGCTGG - Intergenic
1096613051 12:52815711-52815733 GACAATGTCCCCATGGTGCCTGG + Intergenic
1097447272 12:59687399-59687421 GAAAATGTACACAATGTATTTGG - Intronic
1097461058 12:59862411-59862433 AAGAATGTACACTTGGGGCTGGG - Intergenic
1098048085 12:66422958-66422980 GAAAATTAAAACATGGGGCTAGG - Intronic
1098315311 12:69186298-69186320 GAAAATGTGCCCAAGGTGGTTGG - Intergenic
1100180960 12:92085944-92085966 GAAAATATAAACAAGCTGCTTGG + Intronic
1100299215 12:93291801-93291823 GAACATGTGCTCATGGTGGTTGG - Intergenic
1100722219 12:97371189-97371211 GAAAAAGAACACATAGTGCCAGG + Intergenic
1104350473 12:128040843-128040865 GAACATGTACCCAAGGTGGTCGG - Intergenic
1105410264 13:20165946-20165968 GAAAGAGTAGCCATGGTGCTGGG + Intergenic
1107385841 13:39908261-39908283 GAAAATGTATACATAGAACTCGG - Intergenic
1107695626 13:42996937-42996959 GAAAAGCTACACTTGGGGCTCGG - Intergenic
1108538376 13:51410914-51410936 GAAAATAAGCACATGGAGCTGGG + Intronic
1110273908 13:73621294-73621316 GAAATTGCACACAGGGTACTGGG - Intergenic
1111922270 13:94424890-94424912 GAAATTGTACGCAGGGTGGTCGG + Intergenic
1112605942 13:100905734-100905756 GAACATGTACCCAAGGTGGTTGG - Intergenic
1113642829 13:111970569-111970591 GAAAATGAAAACGTGGTGCCAGG + Intergenic
1114935555 14:27532563-27532585 GAAAATGAACTCATGCTGTTAGG + Intergenic
1115425528 14:33254471-33254493 AAAAATGTACACAGGCTGATAGG - Intronic
1115724061 14:36193971-36193993 GTAAATGGACACATGGTATTGGG - Intergenic
1116082636 14:40195067-40195089 GAAAATCTCCACATTGTTCTGGG + Intergenic
1117040420 14:51764091-51764113 CAAAATGCAGACATGATGCTGGG - Intergenic
1118304082 14:64640026-64640048 GAAAATGTGCACATGTTTTTAGG + Intergenic
1120618870 14:86738517-86738539 GAACATGTGCACAAGGTGGTTGG + Intergenic
1120845939 14:89125131-89125153 GAAAATGTTAACATCATGCTTGG + Intronic
1121684022 14:95818685-95818707 GAGAATGTACACAAGGAGCCAGG + Intergenic
1121837533 14:97105654-97105676 TAAAATGTACAAATGGCGTTTGG - Intergenic
1122653825 14:103243453-103243475 GAACATGTGCACAAGGTGGTCGG - Intergenic
1126102250 15:45125915-45125937 GAAAATGTCCACAGGGTGGTTGG - Intronic
1126338270 15:47610561-47610583 ATAAATGTACACATGGTGGCGGG - Intronic
1126988377 15:54341651-54341673 GAAAATGTTAACATGGTTATAGG - Intronic
1127507285 15:59609632-59609654 GAACATGTACCCAAGGTGGTTGG - Intronic
1128271139 15:66311077-66311099 AAGAATGTACACATACTGCTGGG + Intronic
1129479926 15:75815569-75815591 TAAAATGTCCACATGGTTCAAGG + Intergenic
1130724970 15:86429680-86429702 AAAAATGTAGACATGGTTCAAGG - Intronic
1131715447 15:95105813-95105835 GAAAATGTACACTTGGAGACAGG - Intergenic
1131942278 15:97580284-97580306 GAAAATATACAAATGGGGCTGGG - Intergenic
1137624371 16:49898457-49898479 TAAAATGTGTACATGGGGCTGGG - Intergenic
1138148051 16:54629824-54629846 ATAAATGTCCACATGGTGTTTGG + Intergenic
1138318730 16:56092734-56092756 GAGAATTTACACATGGTCCAGGG + Intergenic
1139340074 16:66262702-66262724 GGACTTGAACACATGGTGCTGGG + Intergenic
1139365449 16:66429596-66429618 AAACATGTCCACATGGTGCCAGG + Intronic
1139928967 16:70509981-70510003 GAGAATCTGCTCATGGTGCTGGG - Exonic
1140140792 16:72255551-72255573 GACAATCTACAAATGGGGCTGGG - Intergenic
1140274109 16:73493599-73493621 GGACAGGTTCACATGGTGCTTGG + Intergenic
1141429256 16:83962607-83962629 TAACATGTACACATGGTGGTCGG + Intronic
1146744212 17:35313799-35313821 GAAAATGTTTACATGGGGCAGGG + Intergenic
1150492931 17:65586838-65586860 GGAGATGTACCCAGGGTGCTAGG + Intronic
1151097112 17:71511060-71511082 TAAAATGTGCACATGCTTCTTGG - Intergenic
1155065399 18:22265003-22265025 GAAAATCCACACGTGGTGCTGGG - Intergenic
1156892649 18:42207888-42207910 CAACATGTAGACATTGTGCTAGG + Intergenic
1156942076 18:42780123-42780145 GGACATGTACCCATGGTGTTGGG + Intronic
1159280069 18:66273883-66273905 GAACATGCACCCATGGTGGTCGG - Intergenic
1159670410 18:71214511-71214533 GAACATGTACTCAAGGTGGTTGG + Intergenic
1161934447 19:7362987-7363009 GATAATGTACACAAAGTGCCTGG - Intronic
1162482652 19:10937495-10937517 GAACATGTACCCAAGGTGGTTGG + Intergenic
1164229511 19:23275167-23275189 TAAAATGTCCAAATGGGGCTGGG - Intergenic
1165887877 19:39091974-39091996 TAAAATAAACCCATGGTGCTGGG - Intronic
925933937 2:8735079-8735101 GAACATGAACACAAGCTGCTGGG + Intronic
927740106 2:25561194-25561216 TCAAATGTAGACATGGAGCTTGG - Intronic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
929657586 2:43749429-43749451 GAACATGTACCCAAGGTGGTCGG - Intronic
931991712 2:67796977-67796999 GGAAATGGACACAAGGTGTTGGG - Intergenic
934071271 2:88385991-88386013 GAAAATATACAAATGGGGCAGGG + Intergenic
934155735 2:89198346-89198368 GAACATGTACCCAAGGTGGTTGG - Intergenic
934211586 2:89984413-89984435 GAACATGTACCCAAGGTGGTTGG + Intergenic
935382291 2:102465037-102465059 GAATTTGTGCACATGGTTCTTGG - Intergenic
937556173 2:123159778-123159800 GAAATTGTACAAAAGGTGTTTGG - Intergenic
938971324 2:136435580-136435602 TAAAATGTAGACATAGTTCTTGG - Intergenic
940084259 2:149839956-149839978 GATAAGGGACACATGGTTCTTGG + Intergenic
940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG + Intronic
942209522 2:173656652-173656674 TAAAATATCCACATGGTACTTGG + Intergenic
944556678 2:200894323-200894345 GAACATCTACAAATGGGGCTGGG - Intronic
944564116 2:200970297-200970319 AAAAATGTACACAGAGGGCTGGG + Intergenic
945216321 2:207437887-207437909 GGCACTGTACACATGGTGTTTGG - Intergenic
946125865 2:217562123-217562145 GAACATGTACCCAAGGTGGTTGG - Intronic
948291885 2:236831827-236831849 GATAAGTTACACATTGTGCTGGG + Intergenic
1168845747 20:943441-943463 GAAAATGTGCCCAAGGTGGTTGG + Intergenic
1170604393 20:17864739-17864761 GAAAATATATCTATGGTGCTTGG - Intergenic
1171540936 20:25955604-25955626 GAAAATGTTCCCAAGGTGGTTGG + Intergenic
1171800127 20:29604704-29604726 GAAAATGTTCCCAAGGTGGTTGG - Intergenic
1171843966 20:30251974-30251996 GAAAATGTTCCCAAGGTGGTTGG + Intergenic
1172276125 20:33680309-33680331 GAAAAGGTACCTATGGAGCTTGG - Exonic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1175081664 20:56425734-56425756 GAATATTTACACATGGTTTTAGG + Intronic
1176522071 21:7831677-7831699 GACAATGTTAACATGGTGGTTGG - Intergenic
1177654884 21:24004234-24004256 GACATTTTACACATGGTGTTGGG - Intergenic
1177762962 21:25422755-25422777 GAATATGTGCCCATGGTGCCTGG + Intergenic
1178236855 21:30853118-30853140 TAAAATGTAAAAATGGTGCTGGG + Intergenic
1178422567 21:32453933-32453955 GAAAATGTACTCAAAGGGCTGGG + Intronic
1178656091 21:34461689-34461711 GACAATGTTAACATGGTGGTTGG - Intergenic
1179915079 21:44471857-44471879 GAACATGTACCCAAGGTGGTCGG - Intergenic
949439998 3:4070260-4070282 GAACATGTACCCAAGGTGGTTGG - Intronic
951260952 3:20507786-20507808 GAAAATGAAAATATGGTGCATGG - Intergenic
951862274 3:27266449-27266471 GAATATGTAAATCTGGTGCTCGG - Intronic
953168290 3:40484617-40484639 GAAAATGTACACCTGTGGCAAGG - Intronic
953921387 3:46954327-46954349 GAAAGTGAACACATAGTGGTTGG - Intronic
955619489 3:60847353-60847375 GAAGATCTACACCTGATGCTGGG + Intronic
956670120 3:71681186-71681208 GAAAATGTAAAAATGATACTTGG - Exonic
957593058 3:82225370-82225392 GGAAATGTTCAGCTGGTGCTGGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
964620350 3:158715014-158715036 GTACATGTACAGATGTTGCTGGG + Intronic
966967371 3:185007777-185007799 GTAAATGTACAAATAATGCTAGG + Intronic
968185982 3:196633932-196633954 GAAAATGGGCACGCGGTGCTGGG - Intergenic
969078603 4:4600840-4600862 GAAAATGTCAACAAGCTGCTGGG + Intergenic
970545947 4:17130585-17130607 AAAAATGTAGACATTGGGCTGGG + Intergenic
971188923 4:24408317-24408339 GAAAATCTACACATGGCATTTGG - Intergenic
974877002 4:67713495-67713517 GACAATTTAAACATGGTGCCAGG + Intergenic
975328730 4:73089924-73089946 TAAAAAGTACACATGGTTATTGG + Intronic
976018531 4:80590810-80590832 GAAAATGGTTACATTGTGCTAGG + Intronic
979416052 4:120440270-120440292 GATAATCTACACAAAGTGCTTGG + Intergenic
981089104 4:140714277-140714299 GAACATGTACCCATGGTGGCTGG + Intronic
983693128 4:170496977-170496999 GTAAATGTACCCATGGTGGGGGG - Intergenic
984050198 4:174856206-174856228 GAAAGTGTACCCAAGGTGATTGG - Intronic
984216558 4:176920352-176920374 GAAAAGTTACACATGATACTGGG + Intergenic
984227899 4:177057148-177057170 GATAATGTACTTATAGTGCTTGG - Intergenic
985147623 4:186909828-186909850 GAAAAAGAACAGATGGTGATAGG + Intergenic
986207615 5:5640260-5640282 GCAAATGTTCACCTGGTGGTAGG - Intergenic
988120960 5:26961793-26961815 GATAATGCACTCATGGTGCTAGG - Intronic
988121145 5:26964602-26964624 GATAATGCACTCATAGTGCTAGG - Intronic
988563732 5:32303602-32303624 GAGAATAAACTCATGGTGCTAGG + Intronic
988568032 5:32336107-32336129 GAACATGTACCCAAGGTGGTCGG + Intergenic
988640836 5:33039554-33039576 GAATATGTATACATGGTGGAAGG - Intergenic
989224552 5:39011235-39011257 GGCAATTTACACATGGTGTTGGG + Intronic
989273002 5:39554486-39554508 GAAAATGTGCATTTGTTGCTTGG - Intergenic
990755223 5:59061498-59061520 GACAATGTACACATAGAGGTGGG - Intronic
991127159 5:63082278-63082300 GAAAATATACCCATAGTCCTAGG - Intergenic
991274734 5:64831331-64831353 GTATATATACACATGGTGGTGGG - Intronic
991385157 5:66079584-66079606 GAAACAGTACACTTGGAGCTAGG + Intronic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
994647341 5:102486745-102486767 GACAATGTACTTATGGTACTAGG - Intronic
995281348 5:110339301-110339323 GAAAATGTGCCCAAGGTGGTTGG + Intronic
995601063 5:113796718-113796740 GAAACTGGACAGATGGTGGTGGG + Intergenic
997581321 5:135019219-135019241 GAAAAGTTACATATGGTGTTTGG - Intergenic
999902886 5:156105681-156105703 TAAAATATATAAATGGTGCTTGG - Intronic
1001246159 5:170106841-170106863 GATAATGTACACAAGGTTTTAGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1002548857 5:179972320-179972342 GAAAATGTATGCAAGGTACTAGG - Intronic
1004037673 6:11939462-11939484 GAATATGTACACCTGGCACTAGG - Intergenic
1004820714 6:19365242-19365264 GAAAAAGGAGACATGGTGGTGGG - Intergenic
1006638212 6:35475056-35475078 GAGCTTGTAGACATGGTGCTGGG + Exonic
1006921065 6:37627448-37627470 CCTAATGAACACATGGTGCTTGG + Intergenic
1009346470 6:62617783-62617805 GAACATGTACCCAAGGTGGTTGG - Intergenic
1009706077 6:67253518-67253540 GAAATTGTACATATGGCGATTGG + Intergenic
1011685046 6:89817201-89817223 GAAAATGTGCCCAAGGTGGTCGG - Intronic
1015225700 6:130854497-130854519 AAAAATGAACATAAGGTGCTAGG + Intronic
1015993110 6:138969156-138969178 GAAAATATACACTTGGCCCTGGG + Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1019106914 6:169675515-169675537 GAACATGTACCCAAGGTGGTTGG + Intronic
1020465186 7:8470568-8470590 GAAAAGGTAGACCTGGTGCCTGG + Intronic
1021242413 7:18220023-18220045 TATAATGTACACATAGTGCCTGG + Intronic
1021421562 7:20450621-20450643 GAAAAAGAACACATTGTGTTTGG - Intergenic
1021454415 7:20814017-20814039 GAAAATGTACACAGAGAGCCGGG + Intergenic
1024160675 7:46671870-46671892 GAACATGTACTCAAGGTGGTTGG - Intergenic
1025292370 7:57741857-57741879 GAAAATGTTCCCAAGGTGGTTGG + Intergenic
1025888105 7:65618296-65618318 GAAAATGAATATATGATGCTGGG + Intergenic
1028788604 7:94826548-94826570 GAACATGTACCCAAGGTGGTTGG - Intergenic
1028938176 7:96489121-96489143 GAAAATGTCAACATCATGCTTGG - Intronic
1029236230 7:99121797-99121819 GAAACTGTACACATGGTGTAGGG + Intronic
1030291191 7:107873826-107873848 GAAAATGTAAACATGATGTTTGG - Intergenic
1030648516 7:112091521-112091543 GAATAGGTACTCCTGGTGCTGGG + Intronic
1030761115 7:113352916-113352938 GAACATGTTCACATGTTGATGGG + Intergenic
1031554964 7:123163154-123163176 GAAATTGTATGCATGGTGGTTGG + Intronic
1032327856 7:130949004-130949026 GAAAATGTCATCATGTTGCTTGG - Intergenic
1038304824 8:26389986-26390008 GAAAATGTACCCAAGCAGCTTGG - Intronic
1038695285 8:29801007-29801029 GAAAATGTAAAATTGGGGCTGGG - Intergenic
1041373370 8:57188374-57188396 GAAAAGGTACACATGGCCCAAGG + Intergenic
1044080874 8:87881798-87881820 AATAATGTAGACATGGTTCTTGG + Intergenic
1044436341 8:92168238-92168260 GAAATTGTACACATGCATCTAGG - Intergenic
1044835986 8:96296431-96296453 GAAAAAGAACACATGGGGCTGGG - Intronic
1045707946 8:104948277-104948299 GAATATGTACACAATGAGCTAGG + Intronic
1045959480 8:107950319-107950341 GAAAAAGTAGACATGGTTCTAGG - Intronic
1047135137 8:122069481-122069503 GAACATGTACCCAAGGTGGTTGG + Intergenic
1048807124 8:138251103-138251125 GATGATGTATGCATGGTGCTTGG - Intronic
1048836900 8:138528084-138528106 TAAACTGTGAACATGGTGCTCGG + Intergenic
1050195675 9:3080741-3080763 GAGATTGTACACATTGTCCTTGG + Intergenic
1051149567 9:14065744-14065766 ACAATTGTACGCATGGTGCTTGG + Intergenic
1051877108 9:21804513-21804535 TAAGAGGTACATATGGTGCTAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054164132 9:61703855-61703877 GAAAATGTTCCCAAGGTGGTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056915615 9:90743499-90743521 CAAAATGCAGACATGATGCTGGG - Intergenic
1057348778 9:94276998-94277020 GAACATGTACCCAAGGTGATCGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058746289 9:107994411-107994433 GGAAATTTAAACATGGTGCTGGG - Intergenic
1185788756 X:2912467-2912489 GAACATGTACTCAAGGTGGTCGG - Intronic
1186256190 X:7723123-7723145 GAAAGTTTAAACATGCTGCTTGG - Intergenic
1188285990 X:28326168-28326190 GAACATGTACCCAAGGTGTTCGG + Intergenic
1188832797 X:34920951-34920973 GAAAATGTACTCATTCTACTTGG + Intergenic
1188894881 X:35654709-35654731 AAAAATGTGAACACGGTGCTGGG - Intergenic
1189551961 X:42102555-42102577 GAAAAGGTAGTCATGGTGGTAGG + Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1193302654 X:79908953-79908975 GAACATGTGCCCATGGTGGTTGG - Intergenic
1193658502 X:84226953-84226975 GATAATGTAGAAATGGTACTTGG + Intergenic
1196430792 X:115623069-115623091 GAAAATGTATACATGGCACATGG + Intronic
1196799153 X:119526597-119526619 GCATATGTCCACGTGGTGCTGGG - Intergenic
1197479386 X:126963449-126963471 GAATATGTACCCAAGGTGGTTGG - Intergenic
1197997622 X:132395501-132395523 GAAAATTTACACCTGGTTATGGG - Intronic
1198470865 X:136945604-136945626 GAAAATTTACAAATTGTGCTTGG + Intergenic
1199284769 X:146043525-146043547 GAAAATGTACATTTGAGGCTGGG - Intergenic
1200056080 X:153461994-153462016 GAACATGTGCACAAGGTGGTTGG - Intronic
1200801546 Y:7391822-7391844 GAATATGTTCCCATGGTGGTTGG - Intergenic
1201286179 Y:12380650-12380672 GAACATGTACTCAAGGTGGTCGG + Intergenic
1201951355 Y:19567606-19567628 GAAAGGGTACACCTGGTGCGTGG - Intergenic