ID: 928066227

View in Genome Browser
Species Human (GRCh38)
Location 2:28166963-28166985
Sequence ACTTGGAAATAGATTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928066222_928066227 8 Left 928066222 2:28166932-28166954 CCAAGAGACAGTTAGAAATTTAG 0: 1
1: 1
2: 2
3: 27
4: 269
Right 928066227 2:28166963-28166985 ACTTGGAAATAGATTGAGACTGG 0: 1
1: 0
2: 1
3: 18
4: 217
928066221_928066227 22 Left 928066221 2:28166918-28166940 CCAGGGGGAGATATCCAAGAGAC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 928066227 2:28166963-28166985 ACTTGGAAATAGATTGAGACTGG 0: 1
1: 0
2: 1
3: 18
4: 217
928066220_928066227 23 Left 928066220 2:28166917-28166939 CCCAGGGGGAGATATCCAAGAGA 0: 1
1: 0
2: 0
3: 19
4: 238
Right 928066227 2:28166963-28166985 ACTTGGAAATAGATTGAGACTGG 0: 1
1: 0
2: 1
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928066227 Original CRISPR ACTTGGAAATAGATTGAGAC TGG Intronic
902719098 1:18292253-18292275 ACTTGGAAATAAATGGAGTTTGG - Intronic
903666458 1:25010619-25010641 ACTTGGAAATAGGCAAAGACAGG + Intergenic
904159206 1:28510151-28510173 ATTTGGAACTTGATGGAGACAGG + Intronic
904906054 1:33898031-33898053 CCTTGGAGTTAGATTGAGAGAGG + Intronic
905126666 1:35720120-35720142 ACTTGGAATCAAATTGAAACTGG - Intergenic
907350146 1:53822608-53822630 AGTGGGACAAAGATTGAGACTGG + Intronic
907371919 1:54009329-54009351 ACTAGGAAACAGTTTCAGACAGG - Intronic
907958730 1:59257248-59257270 ACTAGGAAAGAGATTGGGAATGG - Intergenic
908035752 1:60050924-60050946 ACTTGGAAATACATTAGGAAAGG + Intronic
908689895 1:66767210-66767232 ACTTGGAATTAGTTTTAGAGAGG - Intronic
909041669 1:70660632-70660654 ATTTGCTAATAAATTGAGACTGG - Intergenic
909355370 1:74702721-74702743 TCTTGCAAATGGATTGAGAGTGG - Intergenic
911209380 1:95123162-95123184 ACATGTAAAAATATTGAGACAGG + Intronic
914398604 1:147294182-147294204 AATTGGAAATAGATTATGATTGG - Intronic
915801660 1:158800039-158800061 ACTTAGAAACAGACTGAGAATGG - Intergenic
916668128 1:166985647-166985669 ACTTGGAAACAGTTTGAGTCTGG - Intronic
918300538 1:183199788-183199810 ACCTGGAAATAGATTTAGGGAGG + Intronic
919690154 1:200521943-200521965 ACTTGGAGATCTGTTGAGACAGG - Intergenic
919776976 1:201200532-201200554 ACTGGGGACTAGATGGAGACAGG - Intronic
920982810 1:210854216-210854238 ACTTGATAATATATTGAGATTGG - Intronic
921814812 1:219551444-219551466 ACTGAGAAATAGAGAGAGACAGG + Intergenic
922144623 1:222927998-222928020 ACTTGGAAATAAATGCAGATTGG + Intronic
922648139 1:227311851-227311873 ACTTGGAAATAGATGGGAAGAGG - Intronic
1063113220 10:3053927-3053949 ACTTTTAAATGGATTGAGATTGG + Intergenic
1063258834 10:4360346-4360368 ACTTGGGAATAGCTTGAACCTGG + Intergenic
1063579695 10:7294453-7294475 ACTTGGAAATAGATGTAGCTGGG - Intronic
1066325088 10:34350913-34350935 ACTTGGAAATATATTACCACAGG + Intronic
1066503465 10:36017556-36017578 CCTTGGACACAGACTGAGACAGG - Intergenic
1066651996 10:37665179-37665201 ATTTTGAAATTGATTGGGACTGG - Intergenic
1067035767 10:42915418-42915440 ATTTTGAAATTGATTGGGACTGG - Intergenic
1067500670 10:46802154-46802176 ACTTGGAAAAACATGGATACTGG - Intergenic
1067593914 10:47537745-47537767 ACTTGGAAAAACATGGATACTGG + Intronic
1067641025 10:48045858-48045880 ACTTGGAAAAACATGGATACTGG + Intergenic
1068316281 10:55347187-55347209 CCTGGGAAATAGAGGGAGACTGG + Intronic
1070033899 10:72703008-72703030 ATTTGGAAATATAATGTGACTGG + Intronic
1070502448 10:77084340-77084362 ACTAGGAAATAGATTGAGATGGG - Intronic
1071195514 10:83154308-83154330 AGTTGGAAATAAGTTTAGACTGG - Intergenic
1072854889 10:98936318-98936340 ACTTGGAACTCTAGTGAGACAGG - Intronic
1073405777 10:103296493-103296515 ACTTGATAATAGATTGTGCCAGG + Intergenic
1073677656 10:105666601-105666623 ACTTGGAATCAGAGTTAGACAGG - Intergenic
1074325905 10:112450249-112450271 AATTGGAAATAGATTTAAAAAGG - Intronic
1076276910 10:129207844-129207866 ACTTGGAAATAGTTTGACCAGGG - Intergenic
1079492990 11:21010379-21010401 ACTTGGAAAGAGAAGGAGACAGG - Intronic
1086061488 11:82704051-82704073 CCTTGGAAAAAGATTGACATGGG - Intergenic
1086151931 11:83621366-83621388 ACTTTGAAAAACAGTGAGACCGG - Intronic
1087224981 11:95588798-95588820 ACCTCAAAATAGAGTGAGACCGG - Intergenic
1088506130 11:110529284-110529306 AGTTAGAATTAGATTGAGATTGG + Intergenic
1089268566 11:117284902-117284924 CCTGGGCAATAGAGTGAGACTGG + Intronic
1090646856 11:128773285-128773307 ATTTGAAAATAGATAGAGATGGG + Intronic
1091301853 11:134513033-134513055 ATTTGGAAATAAAATGGGACAGG - Intergenic
1092315193 12:7404891-7404913 ACTTGGAGATTGATTTATACAGG + Intronic
1092359793 12:7826745-7826767 ACTTGTAAAAACATAGAGACTGG + Intronic
1093578025 12:20757307-20757329 ACTTGAAAACAGAATGAGAGAGG + Intergenic
1096363314 12:51007042-51007064 GATTGGAAATTGATTGACACTGG - Intronic
1098423070 12:70324968-70324990 ACTTGGGAATAGAGTGAGTCTGG - Intronic
1099349948 12:81553921-81553943 ACTTGGAACCAGATTAAGAATGG + Intronic
1099620319 12:84995649-84995671 ACTAGGAAAAAGCTTGAAACTGG + Intergenic
1100252870 12:92848114-92848136 ATTTGGAAATAAATTTAGAAAGG - Intronic
1103366117 12:120384682-120384704 ACTAGGAAATAGATGGAACCAGG + Intergenic
1105671826 13:22627445-22627467 AATTCAAAATAGATTGAGACTGG + Intergenic
1105875369 13:24547946-24547968 ACTGGGAAATACATAGTGACAGG + Intergenic
1106914139 13:34494242-34494264 ACTAAGAAATAGATTTAGGCTGG + Intergenic
1107636823 13:42400534-42400556 ACTTGGACACAGATTTTGACAGG - Intergenic
1108510969 13:51155659-51155681 ACTTGGAAATATACTGAGAAAGG - Intergenic
1108696269 13:52905102-52905124 ACCTGGAAATAAATGGAGTCAGG - Intergenic
1110486237 13:76047555-76047577 ACTTGGAAATATATTGACAATGG + Intergenic
1110943704 13:81386274-81386296 GCTTGGAACTAAATTGAGAAGGG - Intergenic
1111159951 13:84382050-84382072 ACTAGGAAATAAAATGAGATTGG + Intergenic
1111736114 13:92141388-92141410 ACTTGGAAATATAGTGAGAGGGG + Intronic
1116130440 14:40849518-40849540 ACTTTGAAATAGTCTGAGTCTGG + Intergenic
1118093564 14:62510522-62510544 ACTTGGAAATAAATTTATCCAGG + Intergenic
1120011114 14:79415763-79415785 ACTTCAAGATAGATTGAAACAGG - Intronic
1120489893 14:85164158-85164180 ACTTGGTATTAGGGTGAGACTGG - Intergenic
1123928670 15:25145271-25145293 GTTTGGAATTAGAATGAGACTGG + Intergenic
1124123762 15:26916134-26916156 ACTTGGATATATAATGAAACAGG - Intronic
1124141992 15:27085401-27085423 AGTTGGAAATATATTTACACAGG + Intronic
1124206970 15:27729364-27729386 AATTGGAAATAGGGAGAGACTGG - Intergenic
1125925921 15:43563100-43563122 ACTTTGAAAGAGAGTGAGCCTGG + Intronic
1125939065 15:43662651-43662673 ACTTTGAAAGAGAGTGAGCCTGG + Intronic
1127944638 15:63738725-63738747 ACTTGGAGATAGATTGTTCCAGG - Intronic
1131313683 15:91313514-91313536 ACTTGAAAATAGATTGATAGAGG + Intergenic
1131863786 15:96684381-96684403 ACCTGGAAATTAATTGAGAGAGG + Intergenic
1132247800 15:100310798-100310820 ACTTGCTAATGGATTGAGAAAGG + Intronic
1132311339 15:100860217-100860239 ACTTTGAAATTGAGTAAGACTGG + Intergenic
1132315292 15:100885894-100885916 ACTTGCAAATAGAGTGATAAAGG - Intronic
1133045839 16:3087871-3087893 GCATGGAAATAGATTGAGAGAGG - Intergenic
1133433844 16:5762257-5762279 ACTTGGAAAAATGTTCAGACTGG + Intergenic
1133545962 16:6807323-6807345 ACTTGGCAATAAATTGATAATGG + Intronic
1134228959 16:12414556-12414578 ACTTGGAAAAGGAAAGAGACCGG - Intronic
1138976905 16:62218664-62218686 ACTTGGAAATAGGGTGTGTCTGG - Intergenic
1141538916 16:84703130-84703152 ATTTGGAAACATTTTGAGACCGG + Intronic
1143499035 17:7328275-7328297 ACTTGGAAGGAGATTGAATCTGG - Intronic
1143861255 17:9892479-9892501 CCTGGGAAACAGAGTGAGACTGG - Intergenic
1144042406 17:11424253-11424275 ACATAGAAATAAATTCAGACTGG + Intronic
1144173870 17:12685579-12685601 CCTGGGAGACAGATTGAGACTGG + Intronic
1144438139 17:15259502-15259524 ACAAGGAAATAGACTGAGAGAGG - Intronic
1150419471 17:65019075-65019097 ACTTGGAAGTAGCTTCAGGCAGG - Intronic
1154203404 18:12316808-12316830 ATTTGGAAATGGAATGACACTGG - Intronic
1156318307 18:35993101-35993123 ACTTTGCAAGAGATGGAGACAGG - Exonic
1156787587 18:40934158-40934180 ACTTGGAAATAGAATGACCAAGG - Intergenic
1159283935 18:66324729-66324751 AGTGAGAAATAAATTGAGACTGG + Intergenic
1160008979 18:75089399-75089421 ATTTAGAAATCGATTGAAACGGG - Intergenic
1160036237 18:75304276-75304298 ATTTGGAAAGAGATTGAGGTGGG + Intergenic
1164694160 19:30231269-30231291 ACTTGGAGATAGGCTGAGGCAGG - Intronic
1167266273 19:48484413-48484435 ACATCGAAATAGAATTAGACAGG + Intergenic
925788480 2:7456649-7456671 ATTTGGAAATAAATAAAGACAGG + Intergenic
925932457 2:8720239-8720261 AATTTGAAATAGATTTAAACTGG - Intergenic
926965254 2:18402662-18402684 ACTTGGAAAAAGGTGGAGAAGGG - Intergenic
928066227 2:28166963-28166985 ACTTGGAAATAGATTGAGACTGG + Intronic
929079298 2:38106566-38106588 ACTGAGACATAGATCGAGACAGG + Intronic
930585256 2:53260165-53260187 ACTAAGAAATAGATGGAGTCAGG - Intergenic
936489825 2:112960571-112960593 AGTTGGGAAGAGATTGGGACAGG - Intergenic
937227438 2:120377863-120377885 ACCTGTAAATGGAGTGAGACTGG - Intergenic
937478848 2:122238950-122238972 AGTTGGAATCAGATTGATACTGG + Intergenic
938998119 2:136702226-136702248 ACTGGGAAATAGGTAGAGACTGG - Intergenic
940460971 2:153962414-153962436 ACTTTGAAAAAGATGGAGATAGG + Intronic
945687320 2:212987016-212987038 ACTCTGAAATAGATTGAGCCAGG - Intergenic
946565004 2:220954654-220954676 ATTTAGAAATAGATTTAGAGAGG - Intergenic
946580856 2:221127162-221127184 ACTAGTAAATAAATTGATACCGG + Intergenic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
947862899 2:233374992-233375014 ACTTGAAAACAGATGGAGCCGGG + Intronic
948318713 2:237051783-237051805 ACTTGGAAATAATTTGAGAAGGG + Intergenic
1168922975 20:1556548-1556570 ACTTGGAAATAGAGTTACAGAGG + Intronic
1169558435 20:6772990-6773012 AGTTGGAAACACATTGAAACTGG + Intronic
1170213698 20:13870624-13870646 AAGTTGAAATAGATTGAGGCCGG + Intronic
1170339346 20:15305811-15305833 ACTGGGAATGAGATTGAGAGTGG - Intronic
1170357613 20:15509359-15509381 ACTAAGAAATAGCATGAGACAGG + Intronic
1170912220 20:20584217-20584239 ACTTAGAAATGGAATGAGATTGG - Intronic
1174384530 20:50179340-50179362 ACTGGGAAACAGCTTCAGACTGG - Intergenic
1175067988 20:56306385-56306407 ACTTGAAGGTAGATTGAGCCTGG + Intergenic
1178068978 21:28940271-28940293 ACTTGAAGATAGTTTGAGCCGGG - Intronic
1179807854 21:43851435-43851457 ACATGGAAAGAGATGGGGACAGG + Intergenic
1183825842 22:40386440-40386462 ACTTGGAAACAGCTAGAGACAGG - Intronic
1184611192 22:45604665-45604687 TCCTGGACATAGAATGAGACGGG + Intergenic
949618453 3:5782976-5782998 ACTTGAAAATTGCTTGAAACAGG - Intergenic
949913322 3:8934427-8934449 AATTGGACATAGATTTAAACAGG + Intronic
950135697 3:10579370-10579392 ACTTAGAAACAGACTGAGAAGGG + Intronic
950432804 3:12960765-12960787 AGTTGGCACAAGATTGAGACTGG - Intronic
953779838 3:45858129-45858151 TCTTGGAAATGGATATAGACAGG - Intronic
956216426 3:66854112-66854134 ACTTGGAAATAGGGTTAGACAGG + Intergenic
957030196 3:75231086-75231108 ACTAGGGAACAGATTAAGACCGG - Intergenic
959420343 3:106120566-106120588 ACTTGGGAATAGATTGTCACAGG - Intergenic
960302051 3:116014967-116014989 ACTTGGAAATGAATTGAAAGTGG + Intronic
962641105 3:137387395-137387417 ACTGGGTAATAGATAGAGAAGGG - Intergenic
964245183 3:154643566-154643588 TCTGGGAAAGAGATTGAAACGGG - Intergenic
964369911 3:155989401-155989423 ACCTGGAAAGAGATTGGGATTGG + Intergenic
965415998 3:168393292-168393314 TCTTGGAAATAGATTGTTAAGGG + Intergenic
965841189 3:172907411-172907433 AGTTGGAAATAGATTGAAGAAGG - Intronic
966310985 3:178593679-178593701 AATTGGTAGTAGATAGAGACGGG - Intronic
967375501 3:188796163-188796185 ACTTAGACAGAGATTAAGACAGG + Intronic
967566876 3:190983507-190983529 ACTTGGAAAGAAGTTCAGACTGG + Intergenic
970558834 4:17262460-17262482 ACTTGGATTAAAATTGAGACAGG - Intergenic
976379697 4:84385082-84385104 GCTTGGAAAGAGAAGGAGACAGG + Intergenic
977092191 4:92691573-92691595 TCTTTGAAATATATTGATACAGG - Intronic
978053363 4:104231866-104231888 AATTGGCAATAAATTGACACAGG + Intergenic
979623247 4:122819106-122819128 ATTTGGAAAGAGACTGAGCCAGG - Intergenic
979829196 4:125279813-125279835 ATTTGGAAAGAGACTGAGCCAGG + Intergenic
980066847 4:128198776-128198798 ACTTGGAAAAACAAAGAGACTGG + Intronic
980681915 4:136173524-136173546 TCTTGGAAATAGAATGGAACTGG + Intergenic
981684087 4:147433822-147433844 ACTTGGAAATAAATTTACCCAGG - Intergenic
982244267 4:153334253-153334275 ACCTGGAAATAGATGGGGAGAGG + Intronic
983152723 4:164304616-164304638 ATTTTGAAATAGATTGTGGCAGG + Intronic
983579187 4:169290725-169290747 ACATAGAAAAAGATTAAGACTGG - Intergenic
984384525 4:179038054-179038076 ACTTACAAATAGACTCAGACAGG + Intergenic
984673674 4:182522286-182522308 ACATGAAAATACAGTGAGACAGG - Intronic
987116043 5:14727692-14727714 ACTTGGAACTTGTTTGGGACTGG + Intronic
990194021 5:53292734-53292756 TCTGGGAAATTGACTGAGACTGG + Intergenic
992512811 5:77456303-77456325 ACTCAGAAATAGATTTAGTCTGG - Intronic
993289036 5:86041084-86041106 ACTTGGCAGAAGATTGAGATAGG - Intergenic
995841175 5:116444769-116444791 ACATGGAAATAGATGCAGGCAGG - Exonic
999639538 5:153658331-153658353 ACTTGGCAACAGATGGAGGCTGG - Intronic
999681773 5:154067265-154067287 ACTTGGAGATAAATTTTGACTGG - Intronic
999989709 5:157038496-157038518 ACATAGAAATAGATTCAGAGAGG - Intronic
1002367505 5:178724660-178724682 ACTTGGAATGGGATTGAGAATGG - Intronic
1002385993 5:178867801-178867823 ACTTGGAATGGGATTGAGAATGG + Intronic
1003731545 6:8830058-8830080 ACTTGGAAACAGACTGAGTTGGG + Intergenic
1004059022 6:12172324-12172346 ACTGGGAACTAGATTGTTACTGG + Intergenic
1005381457 6:25238750-25238772 ACTTGGAGATTGCTTGAGCCTGG - Intergenic
1007910154 6:45505392-45505414 ACTTGGAGTTATATTGAGAAGGG - Intronic
1008784115 6:55144745-55144767 ACTTGGAAATTTATGGAGAAAGG - Intronic
1010339609 6:74732802-74732824 ACTTTGAAATAGTCTGACACTGG - Intergenic
1011049415 6:83127744-83127766 ACTTAGTAATAGATTGATAAGGG + Intronic
1011605333 6:89098898-89098920 ATTTGGAACGAGATTTAGACTGG + Exonic
1013448662 6:110257112-110257134 ACTTGGAAATAGATACAAATTGG + Intronic
1013921806 6:115414944-115414966 ACTTCTAAATTGATTGAGACTGG - Intergenic
1014987445 6:128029208-128029230 ACTTGGCAAGAGAGGGAGACAGG - Intronic
1015542429 6:134328635-134328657 ACTTAGAAAAAGAATGAGGCTGG - Intergenic
1016424539 6:143920298-143920320 ACTTGGAAAGAGATCGTGAATGG + Intronic
1016960369 6:149667131-149667153 ACTTGAAGATAGGTTGATACTGG + Intronic
1017611121 6:156187468-156187490 AGTTGGAAAGAGAATGAGTCAGG + Intergenic
1018977885 6:168579341-168579363 ACTTTAAAATAGACTGTGACAGG - Intronic
1019560985 7:1657139-1657161 ACTTGGAAAGAGATTGATTATGG + Intergenic
1021167229 7:17356323-17356345 AATTGGGAATAAATTCAGACTGG - Intergenic
1021960532 7:25868337-25868359 ACCTGTAAATAGATAGAGAGAGG - Intergenic
1023046919 7:36218155-36218177 ACTTGAAAATAGAATGATACTGG - Intronic
1024032349 7:45472330-45472352 ACTTGAAACTACATAGAGACAGG + Intergenic
1024130511 7:46347909-46347931 ATATGGAAAGAGATAGAGACAGG + Intergenic
1024138610 7:46437233-46437255 ACTTGGATATAGATACAGAAAGG - Intergenic
1024160016 7:46664298-46664320 ACTTGAAGATAGATGGAAACTGG - Intergenic
1025919176 7:65894446-65894468 ACTTAGAAATAAATTGGGGCCGG + Intronic
1029168293 7:98612369-98612391 ACTAGGAAACAGTTTGAGAAAGG - Intergenic
1032610415 7:133406854-133406876 ACTTGGACAGAGAGTGAGAGGGG + Intronic
1032742446 7:134752486-134752508 ACTTGGAAATAGATTTATGAAGG - Intronic
1033844073 7:145411314-145411336 TCTGGGAACTAGATTGAAACAGG + Intergenic
1034309318 7:150072684-150072706 ACTGGGAAATAAACTGAGGCAGG + Intergenic
1035870379 8:3130883-3130905 TGTTGCAAATAGAGTGAGACTGG - Intronic
1036099562 8:5763486-5763508 ACTTTTACATAGAATGAGACAGG + Intergenic
1036765305 8:11546168-11546190 AGTTGGAAAAAGGTTGAGTCAGG + Intronic
1037528952 8:19756052-19756074 ACTTGGAAATAGACGCAGAAAGG - Intronic
1039147216 8:34462253-34462275 CCTTGGAAATGGATAGACACAGG - Intergenic
1039836053 8:41257065-41257087 ACTTGGGAATGGATTGAGGGTGG - Intergenic
1042367825 8:67956728-67956750 ACTGGGAAACAGATGGAAACTGG + Intronic
1043206656 8:77452307-77452329 ATTTGGAAAAAGATTGAGCAAGG + Intergenic
1043303456 8:78763431-78763453 ATTTGGAAGTAGATTTAGATTGG + Intronic
1049304133 8:141890483-141890505 AATTGCAAATAGACTAAGACAGG - Intergenic
1050106372 9:2170451-2170473 AGTTGGAAATAGAAGGAAACAGG + Exonic
1050632022 9:7569787-7569809 ACTTTGAAATGGATTGGTACTGG + Intergenic
1050837411 9:10100484-10100506 ACTCGGAAATACATTTAGAAAGG + Intronic
1051065525 9:13097831-13097853 ACTAGCAAGGAGATTGAGACTGG + Intergenic
1052435270 9:28419419-28419441 ATGTGGAAATAGATTCAGAGGGG + Intronic
1055151188 9:73002722-73002744 ATTTGAAAATAGATTTAGATTGG - Intronic
1057546325 9:96022080-96022102 ACTTGGTAACAGGTTGAGAGCGG - Intergenic
1058694667 9:107549073-107549095 TCTTGGAGGTAGCTTGAGACTGG + Intergenic
1059980906 9:119770756-119770778 AGTTGGAAAAAGAGTGAAACAGG - Intergenic
1061991638 9:134162614-134162636 AATTGCAAATAGATTCAAACTGG + Intergenic
1185985870 X:4832712-4832734 AATTGGAAATAAAATAAGACAGG + Intergenic
1187612543 X:20958132-20958154 ACTAGGACATAAATTGAGAGAGG - Intergenic
1189449635 X:41116815-41116837 ACCTGGAAAAAGAATGAGAGAGG + Intronic
1190292807 X:49003922-49003944 TCATGCAAATAGAATGAGACAGG + Intergenic
1190441879 X:50482906-50482928 ACTTGGTAGTAGATTGAGAGTGG + Intergenic
1192789975 X:74371946-74371968 GCTTGGAAATAGACTGAAGCAGG - Intergenic
1193611552 X:83637518-83637540 ACTTCTAAATAGATAGAAACAGG + Intergenic
1194134557 X:90124797-90124819 ACTTAGAAATAGTTTGATATTGG + Intergenic
1195136373 X:101910778-101910800 ACTAGAAAATAGATTGAAAAAGG + Intronic
1195814918 X:108874248-108874270 AATTGCACATTGATTGAGACAGG - Intergenic
1196503813 X:116416863-116416885 ATTGGTAAATAGATTGATACAGG + Intergenic
1200480333 Y:3694907-3694929 ACTTAGAAATAGTTTGATATTGG + Intergenic