ID: 928068229

View in Genome Browser
Species Human (GRCh38)
Location 2:28188325-28188347
Sequence CATTTGAAACTGATTTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928068226_928068229 24 Left 928068226 2:28188278-28188300 CCTATTGACTGCTTCCTTAAACA 0: 1
1: 0
2: 1
3: 13
4: 176
Right 928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG 0: 1
1: 0
2: 0
3: 10
4: 213
928068228_928068229 0 Left 928068228 2:28188302-28188324 CCTTGTATTCTTTGTGATAAATA 0: 1
1: 1
2: 1
3: 26
4: 459
Right 928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG 0: 1
1: 0
2: 0
3: 10
4: 213
928068225_928068229 25 Left 928068225 2:28188277-28188299 CCCTATTGACTGCTTCCTTAAAC 0: 1
1: 0
2: 0
3: 18
4: 290
Right 928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG 0: 1
1: 0
2: 0
3: 10
4: 213
928068227_928068229 10 Left 928068227 2:28188292-28188314 CCTTAAACAGCCTTGTATTCTTT 0: 1
1: 0
2: 1
3: 24
4: 303
Right 928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG 0: 1
1: 0
2: 0
3: 10
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928068229 Original CRISPR CATTTGAAACTGATTTACTC TGG Intronic
901563842 1:10095709-10095731 CATTTGACACTAATTTGCTAAGG - Intronic
902095821 1:13944528-13944550 CATTTGAAACAACTTTATTCAGG - Intergenic
903529808 1:24021556-24021578 CATTTGAAGCTCATTCCCTCAGG - Intergenic
904274452 1:29371167-29371189 CATTTTAAACTGCTCTTCTCCGG + Intergenic
906936326 1:50217075-50217097 CATTTCAAAGTCATTTCCTCAGG - Intergenic
908664927 1:66479558-66479580 TTTTAAAAACTGATTTACTCAGG + Intergenic
909320803 1:74283196-74283218 CATTCGAAAATGGTTTCCTCGGG + Intronic
909467487 1:75989327-75989349 CATGTGAAAATGAAGTACTCAGG - Intergenic
910769950 1:90821063-90821085 CACTTTAAACTGCTTTATTCTGG - Intergenic
910810999 1:91236440-91236462 CATTTGAAAATGCTCTTCTCTGG + Intergenic
911802235 1:102156610-102156632 CATTTGAAACTAATCTACCATGG - Intergenic
913975964 1:143455818-143455840 CATTTGAAACTGTTTTTGGCAGG - Intergenic
914070361 1:144281440-144281462 CATTTGAAACTGTTTTTGGCAGG - Intergenic
914108794 1:144684914-144684936 CATTTGAAACTGTTTTTGGCAGG + Intergenic
916386853 1:164282876-164282898 CATTTGAAAATGATATGCTTAGG - Intergenic
917511696 1:175674303-175674325 CATTTTAAACAGAATTGCTCAGG - Intronic
917645619 1:177026049-177026071 CCTTTGGAACTGATGTCCTCAGG + Intronic
918766423 1:188490297-188490319 GATGTGACACTGATTCACTCAGG + Intergenic
921166207 1:212509189-212509211 AATTTGATACTGATGTGCTCTGG + Intergenic
921497965 1:215864045-215864067 CCTTTGAAGCTGATTCACTAAGG - Intronic
921591835 1:217013108-217013130 CATTTGAACTTGATTACCTCTGG + Intronic
923150984 1:231233010-231233032 CATCTGACACTGATCTACTCAGG + Intronic
1062780494 10:200935-200957 CATCTGAAACTCATTTTTTCTGG - Intronic
1065127534 10:22587958-22587980 TATTTGATACTGATCTATTCGGG - Intronic
1066244309 10:33567618-33567640 AATTTGAAACTGCATTACTGGGG - Intergenic
1066482862 10:35813671-35813693 CATTTAAATGTGATTTACTAAGG - Intergenic
1068259984 10:54567295-54567317 CATTTGACACTGTCTTTCTCAGG + Intronic
1069882439 10:71602183-71602205 GATTTGAAAGTCATTCACTCTGG + Intronic
1070871979 10:79763291-79763313 CATTTTAAACGAATTTACCCTGG - Intergenic
1072440273 10:95448145-95448167 CACTGTAAACTGATTTACACTGG + Intronic
1073086026 10:100889635-100889657 CATTTGGAACTGTTCTACGCTGG + Intergenic
1073158968 10:101373216-101373238 CATTTGAATCTGATTCCCACTGG + Intronic
1075867548 10:125739097-125739119 CAATTGAAACTGATTTAAAAGGG - Intronic
1076928732 10:133512215-133512237 CTTTTGAAACTGATGTACACTGG + Intergenic
1078849885 11:15154020-15154042 CATTTGAATGAGATTTACTTTGG + Intronic
1080364736 11:31559964-31559986 AATTTGAAAATTATTTACTGTGG - Intronic
1080982109 11:37420534-37420556 CATTTGAGATTGATTTATTTTGG + Intergenic
1081344680 11:41969391-41969413 CATTTGGAACTGAATTAGTATGG + Intergenic
1081345170 11:41976647-41976669 AACTTGAGACTGATTTATTCAGG + Intergenic
1081510311 11:43765264-43765286 CATTTGAAAGGTATTTTCTCTGG + Intronic
1081883460 11:46474270-46474292 CATTTGAAAGTATTTTCCTCCGG - Intronic
1085901606 11:80706844-80706866 CATTTCAAGCTGATTTTCTATGG - Intergenic
1085913253 11:80853638-80853660 CATTTTAAACAGCTTTACTAAGG - Intergenic
1086664116 11:89458210-89458232 CATTTGCAAAAGATTTAATCTGG + Intronic
1094155842 12:27336126-27336148 CATTGACAACTGAGTTACTCGGG + Intronic
1094653725 12:32401146-32401168 CAAATGAAAATGATTTACTTTGG + Intronic
1095621604 12:44262540-44262562 CACATGAAACTTTTTTACTCTGG - Intronic
1096329237 12:50695044-50695066 AATTTGTAACTGATTATCTCTGG + Intronic
1097317826 12:58191240-58191262 CATTTGAAATTTATTTTCTTGGG + Intergenic
1098209193 12:68144952-68144974 CATTTGATAATTGTTTACTCAGG - Intergenic
1099339301 12:81407933-81407955 CTTTTGAAAATTATTTTCTCAGG - Intronic
1100114989 12:91293932-91293954 CATTTTCAACTGATGTACCCAGG + Intergenic
1101162669 12:101994731-101994753 CATTTGAGACTTGTTTACTTTGG - Intronic
1101276015 12:103202322-103202344 CTTTTGAGACCCATTTACTCAGG + Intergenic
1102056654 12:109901252-109901274 CATTACAAAGTGATTTGCTCAGG - Intronic
1102073190 12:110038715-110038737 CATTTTAACCAGATTTTCTCAGG + Exonic
1102267009 12:111494799-111494821 GTTTTGAAAGTGATTTTCTCTGG - Intronic
1104354084 12:128070020-128070042 CATTTCAAAATGGATTACTCAGG + Intergenic
1105223275 13:18353918-18353940 CATTTGAAACTGTTTTTGGCAGG + Intergenic
1107424346 13:40277960-40277982 CATTTTAAACTTAATTACTATGG + Intergenic
1108872042 13:54999708-54999730 CATTTAAAAGTGATTTATTGAGG - Intergenic
1108975405 13:56437690-56437712 TATTTGACATTGATTTTCTCTGG - Intergenic
1109790514 13:67241670-67241692 CATATAAAACTTATTTTCTCAGG - Intergenic
1112138983 13:96617228-96617250 CATTTGAAATTGAGTTAGTAAGG - Intronic
1113229570 13:108197104-108197126 TATTGCAAACTGATTTTCTCTGG - Intergenic
1116557826 14:46335181-46335203 CACTTGAGACTGGTTTCCTCAGG - Intergenic
1117203479 14:53416651-53416673 CATTTGAATCTACTTTACTTTGG + Intergenic
1117219189 14:53585142-53585164 CATTTGATACTGAGTTCATCTGG + Intergenic
1118778371 14:68988858-68988880 CAGATGAAACTGATCTCCTCTGG - Intergenic
1120483637 14:85083596-85083618 CTTTGGAAACTGTTTTAGTCAGG - Intergenic
1120976432 14:90253031-90253053 CATTTCAAACTTATGTACGCAGG - Intergenic
1122331175 14:100915136-100915158 CATAGGAAACTCATTTACACTGG - Intergenic
1129818073 15:78573761-78573783 CATTTGATAGTGCTTTGCTCTGG - Intronic
1137504206 16:49037095-49037117 CATTTGTTATTGATTTACTGAGG - Intergenic
1140961882 16:79921870-79921892 CATTTGATACTGATGTACCTTGG - Intergenic
1150642531 17:66959170-66959192 CATTTGAACTTGATTTCATCTGG + Intergenic
1151447265 17:74175526-74175548 CATTAGAGACTGATTTATTTAGG - Intergenic
1151512530 17:74570130-74570152 CCTTTGAAGCAGATGTACTCTGG + Intergenic
1151937165 17:77269571-77269593 CATTTGAAAATGAACAACTCAGG + Intergenic
1152036468 17:77876144-77876166 CATTTGATGCTGACTCACTCTGG - Intergenic
1154442727 18:14407105-14407127 AATTTGACAATCATTTACTCAGG - Intergenic
1155491514 18:26405731-26405753 CATTTGAAAATGCTTAACCCGGG - Intergenic
1156142119 18:34126307-34126329 AATTTGAAACTGCGTTAGTCTGG + Intronic
1158431569 18:57392272-57392294 GATTTGAAGGTGATTTTCTCTGG - Intergenic
1159849106 18:73505161-73505183 CATTTGCCACTGATTTTCTTAGG + Intergenic
1164203612 19:23039604-23039626 AATTTGAAACAAATTTATTCAGG + Intergenic
927312415 2:21646291-21646313 CAAGTGAAACTGCTTTGCTCAGG - Intergenic
928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG + Intronic
928348710 2:30525374-30525396 CATTAGAAATTGATATTCTCTGG - Intronic
929769536 2:44880033-44880055 TATTTGAAACTGATTCTCACAGG - Intergenic
930310960 2:49738877-49738899 CAATTTAATCTGATTTTCTCTGG + Intergenic
931227641 2:60347519-60347541 AATTAGAAAGTGATTGACTCTGG + Intergenic
932542731 2:72673281-72673303 CAGTTGAATCTGAATTACTGAGG - Intronic
932889735 2:75581869-75581891 CATTTGAAAAATATTTTCTCTGG - Intergenic
934180662 2:89616803-89616825 CATTTGAAACTGTTTTTGGCAGG - Intergenic
934290962 2:91691059-91691081 CATTTGAAACTGTTTTTGGCAGG - Intergenic
937945062 2:127326013-127326035 CATTTGAAAATGAGTAACTCTGG - Intronic
939371597 2:141308154-141308176 CATTTGCATCTCATTAACTCTGG - Intronic
939433042 2:142135280-142135302 AACTTGAAACAGAGTTACTCTGG + Intergenic
939683865 2:145173393-145173415 TATTTTAAACTGATATATTCAGG + Intergenic
940018645 2:149133449-149133471 GAAGTGAAACAGATTTACTCTGG - Intronic
940173973 2:150858731-150858753 CATTTGAAAACAAATTACTCTGG - Intergenic
941265798 2:163360039-163360061 CAATTGAAAATGGATTACTCTGG + Intergenic
941344209 2:164347903-164347925 TATTTGAAGCTGATTGTCTCTGG + Intergenic
942239480 2:173946493-173946515 CATTTCCAACTCATTTCCTCAGG + Intronic
943128239 2:183823587-183823609 CATTTCAAATTCATTTACTTTGG - Intergenic
944369961 2:198971309-198971331 TATTTAAAAATGATTTATTCAGG - Intergenic
945302351 2:208226309-208226331 CGTTTGACACTGATCTCCTCTGG + Intergenic
1169316417 20:4594169-4594191 CACTTGAAAGTAATTTACTAAGG - Intergenic
1169789547 20:9395078-9395100 TATTTGCAACTGATTTAATGGGG - Intronic
1170262204 20:14422903-14422925 CATTTGAACCTGAAAGACTCGGG + Intronic
1173324755 20:42022721-42022743 CTTCTGAGACTGATTTCCTCTGG + Intergenic
1174668028 20:52278607-52278629 CATTTGAAAATGCATTTCTCTGG + Intergenic
1175862469 20:62157632-62157654 CACTTGAAACTGGTTTAATCTGG + Intronic
1176453358 21:6884088-6884110 AATTTGACAATCATTTACTCAGG + Intergenic
1176731826 21:10506354-10506376 CATTTGAAACTGTTTTTGGCAGG + Intergenic
1176831533 21:13749136-13749158 AATTTGACAATCATTTACTCAGG + Intergenic
1178390383 21:32192949-32192971 GATTTTAATCTGATTTAATCAGG - Intergenic
1179729227 21:43358390-43358412 CTTGTGAAAGTGATTTACTGGGG + Intergenic
1181799269 22:25333792-25333814 AAGTGGAAACTGATGTACTCTGG - Intergenic
1182914640 22:34018280-34018302 AATTTGAAACAGACTTACTCAGG - Intergenic
1183131235 22:35838856-35838878 TATTTGAAACTTCTTTCCTCTGG + Intronic
949971923 3:9414896-9414918 GATTTGGAACTATTTTACTCAGG + Intronic
950646590 3:14380975-14380997 TATTTGAATTTGATTTTCTCTGG + Intergenic
953162497 3:40434165-40434187 GATTTTCAACTGATTTAATCAGG + Intergenic
953939794 3:47083677-47083699 CATTTCAACTTGAATTACTCAGG - Intronic
955805924 3:62734345-62734367 AATTTGAAATTTATTTACTGAGG + Intronic
956230520 3:67011032-67011054 CATTTTAAACTGCTTTACATAGG - Exonic
956443000 3:69298460-69298482 CATTTTAAACAGACTCACTCTGG - Intronic
956599333 3:71002488-71002510 CATGTGAAACTGCTTAGCTCGGG - Intronic
956611927 3:71132789-71132811 CATTTGTAACTTAGTTACCCAGG - Intronic
957174980 3:76796392-76796414 CCTGTGAAAGTGATTTTCTCTGG - Intronic
964002448 3:151791853-151791875 CTTTTGGAACTGAATTACTTTGG - Intergenic
965337314 3:167442859-167442881 CATTTGACACTGATTGATTTAGG - Intronic
967215037 3:187202616-187202638 TAATTTAAACTGATTTGCTCTGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968112290 3:196058665-196058687 CTTTTGGAACTTATTTATTCAGG + Intronic
969141001 4:5071723-5071745 CATTTGAAAGTGATTTGCATTGG + Intronic
970190868 4:13515668-13515690 CAGTTGAAACTGCTTCTCTCTGG + Intergenic
972054944 4:34789849-34789871 AATATGAAACTGATGTACTGAGG + Intergenic
972097974 4:35372444-35372466 CATTTGAAACTGAGTTGGTATGG + Intergenic
972169382 4:36326566-36326588 CTTTTGAGACTGAGTTCCTCAGG + Intronic
972968231 4:44539306-44539328 TATTTTAAACTGATTTATTGAGG - Intergenic
973132298 4:46662604-46662626 CATTTTAATCTATTTTACTCAGG + Intergenic
974207154 4:58720215-58720237 CAACTGAAACTTAATTACTCTGG + Intergenic
975207120 4:71657912-71657934 CATTTGAAAATGATTGATTAAGG - Intergenic
976609456 4:87014812-87014834 CAGGTGTATCTGATTTACTCTGG + Intronic
977119340 4:93077468-93077490 GATTTGAAACTGATTATTTCTGG - Intronic
978211617 4:106144209-106144231 AATTTGGAACTGATATACTGTGG + Intronic
979342370 4:119541457-119541479 TATTTGAAACAGATTTCCACTGG + Intronic
980700817 4:136427776-136427798 CATTTGAAAGTGATGTCCTGTGG + Intergenic
981874976 4:149531083-149531105 CATGTGAAAAAGTTTTACTCAGG + Intergenic
982891666 4:160861033-160861055 GATTTGAAAATCATTTACCCTGG - Intergenic
982944950 4:161609575-161609597 CAATTTGAACTGATTTAATCTGG - Intronic
983473330 4:168183930-168183952 AATTTGAAACTGATTTGTTAGGG + Intronic
984646806 4:182229015-182229037 TATTAGAAACTTATTTACACGGG - Intronic
986507466 5:8467224-8467246 CATAGGTAACTGATTTGCTCTGG - Intergenic
987824870 5:23017849-23017871 CATTTAAAACTGAGTGAATCTGG - Intergenic
990048063 5:51458815-51458837 CATTTGAAGGTTATTTTCTCAGG + Intergenic
992220329 5:74565732-74565754 CTTTTGAAACTCATTTCCCCAGG + Intergenic
993024343 5:82628449-82628471 CACTAGAAACTGAGTTTCTCTGG - Intergenic
993127149 5:83849550-83849572 CATTTCAGACTGAAATACTCGGG - Intergenic
995051163 5:107705475-107705497 CATTTCAAATTGAATTACACAGG + Intergenic
996249171 5:121306358-121306380 CATTTTAAGCTGACTTACACAGG + Intergenic
996581137 5:125033692-125033714 CATTTTTAATTGATTTACTTAGG - Intergenic
996653426 5:125911204-125911226 TTTGTGAAACTGATTTTCTCTGG + Intergenic
997346429 5:133195726-133195748 GATGTGAAACAGATTCACTCTGG - Intergenic
997557603 5:134814532-134814554 AATTTAAAACGGTTTTACTCAGG + Intronic
997916116 5:137927434-137927456 CATTTTAATCTCATTTAATCTGG - Intronic
998607759 5:143652692-143652714 CTTTTAAGACTGAATTACTCTGG + Intergenic
999870841 5:155748957-155748979 CATTTGAGAATGATTTTCTCAGG + Intergenic
1000224311 5:159244987-159245009 CAATTTAAAGTGATTTACTATGG + Intergenic
1000723819 5:164742861-164742883 CTTTTGACACTGATTTTCTTAGG + Intergenic
1000805548 5:165786133-165786155 CTTTTAAAACTGACTTCCTCAGG + Intergenic
1007892062 6:45304240-45304262 CATTTAAAACTGCTTTATACAGG + Intronic
1008320749 6:50110430-50110452 CTTTTGAAATTGTTTCACTCAGG - Intergenic
1009245162 6:61228386-61228408 CATTTGAGACTGAGTTTCTCTGG - Intergenic
1010207780 6:73338323-73338345 CATTTTCAACAGATTTACTGAGG - Intergenic
1010371737 6:75117934-75117956 TTCTTGAAACTGATTTTCTCAGG + Intronic
1010647547 6:78409798-78409820 CATTTCATCCTGATTTAATCTGG + Intergenic
1011837860 6:91456386-91456408 CATCTGAAGCTTATTTACTCAGG - Intergenic
1013737525 6:113245146-113245168 AATTTAAAACTGATCTATTCTGG - Intergenic
1014583273 6:123164231-123164253 CTATTGAAAGTGATTTTCTCTGG - Intergenic
1018335946 6:162789738-162789760 CAATAGAAACTGATTTCCTGTGG + Intronic
1018528604 6:164740038-164740060 CCCTTGGAACTGAATTACTCAGG - Intergenic
1023556375 7:41427408-41427430 CTTTTAAAAATGATTTATTCAGG - Intergenic
1024148942 7:46548439-46548461 CATTTGTTATTGATTTTCTCTGG + Intergenic
1026410503 7:70116619-70116641 CATTTGAAACAGAGTTCCTTTGG - Intronic
1032489767 7:132315641-132315663 CATTTGAATGTGCTTCACTCGGG - Intronic
1035879397 8:3228062-3228084 CATTTTAAAATGTTTTAGTCTGG - Intronic
1038977745 8:32719602-32719624 CATTTGTAACTGTTTGAATCAGG + Intronic
1041148835 8:54910775-54910797 CTTTTGAAGCTCATTTCCTCAGG + Intergenic
1043252554 8:78093373-78093395 CAGTTAAAACTGATTTATTTTGG - Intergenic
1044260050 8:90108831-90108853 AATTTGAAAATGATTTACCTAGG + Intergenic
1044752605 8:95430738-95430760 GATTTGAAACTTCTTTACCCAGG - Intergenic
1045161242 8:99547595-99547617 CTTTTTAAATTGATTTAGTCTGG - Intronic
1045710488 8:104977778-104977800 AATTTGAAACTCATTTATCCAGG + Intronic
1046373447 8:113343486-113343508 CATTTTAAACTGTTTGACACTGG - Intronic
1046406993 8:113787148-113787170 TATTTGCACCTGTTTTACTCTGG + Intergenic
1047913698 8:129558967-129558989 CATGTGACACTGATTTATTGGGG - Intergenic
1048307429 8:133294140-133294162 CATTTGAGCCTGATTTCTTCAGG + Intronic
1048535535 8:135290991-135291013 CACTTGAAACTGAAAAACTCTGG - Intergenic
1050382942 9:5050202-5050224 AAATGGAAACTGATTTACACTGG - Intronic
1050433819 9:5588571-5588593 CATTTGAAACTGATTGTTTGAGG + Intergenic
1050502264 9:6311288-6311310 GAGTTGAAACTGTTTTACTGGGG - Intergenic
1050849057 9:10261377-10261399 CATTTGAAATTGAGCTACCCTGG + Intronic
1054737082 9:68765134-68765156 CAATTGTAACTGATTTCCTTTGG - Intronic
1060672710 9:125484189-125484211 CTTTTCAAACTGATTGACTTCGG - Intronic
1061998336 9:134200840-134200862 CCTTTGAGACTGGCTTACTCTGG + Intergenic
1062163368 9:135092440-135092462 TCTTTTAAAATGATTTACTCAGG - Intronic
1203515822 Un_GL000213v1:427-449 AATTTGACAATCATTTACTCAGG - Intergenic
1185913304 X:4006375-4006397 CATTTGAAAGCAATTTTCTCTGG - Intergenic
1186231618 X:7461397-7461419 CATTTTAATCTATTTTACTCAGG + Intergenic
1186275097 X:7929901-7929923 CGTTTGAAACTAAATTACTAAGG - Intergenic
1188097181 X:26038643-26038665 CCTTTTAAACTTATTTACCCAGG + Intergenic
1188773232 X:34180959-34180981 CATGTGAAAGGGATTTACTCTGG - Intergenic
1193750816 X:85341276-85341298 CAATTGAAAATGATTGCCTCTGG + Intronic
1195529290 X:105933658-105933680 CATTTGAAAATTATTTATGCAGG + Intronic
1195743021 X:108085233-108085255 CATTGGAAAGTTATTTAATCAGG + Intronic
1196679261 X:118454228-118454250 CATTGGAAACTGACTTCCTTGGG + Intergenic
1196783301 X:119401259-119401281 CATTTGACACTAATTTAGTCAGG + Intronic
1197537794 X:127711347-127711369 CTTGTGAAAGTGATTTTCTCTGG - Intergenic
1197830177 X:130633390-130633412 CATTATAAACTGATCTTCTCTGG - Intronic
1200176866 X:154123134-154123156 CATTTTAAAATGTTTTTCTCTGG - Intergenic