ID: 928069513

View in Genome Browser
Species Human (GRCh38)
Location 2:28200732-28200754
Sequence CTAGTTTACCAGGTATCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928069513 Original CRISPR CTAGTTTACCAGGTATCTAT GGG Intronic
903309560 1:22443957-22443979 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
905696681 1:39979782-39979804 CTATTTTGCCAGGCATATATGGG - Intergenic
910723121 1:90309511-90309533 GTGGTTTACCAGGTTTCTCTAGG + Intergenic
913473052 1:119209379-119209401 CTAATTTATCAGATAACTATTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
920795284 1:209131047-209131069 CTAGTTTTCCAGGTTTCCTTGGG - Intergenic
923779482 1:237009400-237009422 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
923803866 1:237237415-237237437 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
1067958530 10:50820877-50820899 CTAGATTACAAGGTGTCTAAGGG + Intronic
1070708586 10:78659937-78659959 GCATTTTACCAGGTAACTATGGG - Intergenic
1078993873 11:16676932-16676954 CTAGATTACCAGGAATATGTGGG + Intronic
1082866403 11:57903655-57903677 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1090466381 11:126938131-126938153 CTACTTTGCCAGGTAGGTATAGG - Intronic
1093724912 12:22493556-22493578 TTACTTTAACAGATATCTATAGG + Intronic
1093812205 12:23504780-23504802 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1094212367 12:27905946-27905968 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1096805468 12:54138481-54138503 CTTGATCACCAGGTATCTCTGGG - Intergenic
1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG + Intronic
1097536376 12:60875576-60875598 CAAGTTCACTAGGTATCTACTGG + Intergenic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG + Intergenic
1101609421 12:106277040-106277062 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
1102444424 12:112990892-112990914 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1107072894 13:36291051-36291073 CTAGTTTGTCAGGTTTCTTTGGG - Intronic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1114156817 14:20112965-20112987 ATAGTTTACCAGATTACTATTGG - Intergenic
1114996900 14:28365268-28365290 CTACAGTACCAGGTTTCTATGGG - Intergenic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1126057555 15:44745012-44745034 CTAGATTACCAGGAATATGTGGG - Intronic
1128036005 15:64527213-64527235 CTAGTTTGCCAGGTATTTTGAGG + Intronic
1134338686 16:13325439-13325461 CTAGTTTTTCAGGTTTCTTTAGG + Intergenic
1149374322 17:56029036-56029058 CTAGGTCACCAGGTAGCAATTGG + Intergenic
1149397484 17:56259847-56259869 CCATTCTACCAGGTATATATAGG + Intronic
1159992711 18:74928798-74928820 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929302525 2:40322195-40322217 CGAGTTTTCCAGGTATCCCTGGG + Intronic
931896910 2:66742601-66742623 CTAATTCACCAGATATCTCTTGG - Intergenic
932653070 2:73581094-73581116 CTAGTTTCCCTGGTATACATGGG + Intronic
937646124 2:124268100-124268122 CTAGCTTGGCCGGTATCTATTGG - Intronic
938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG + Intergenic
938252251 2:129824659-129824681 AGAGTTTACCTGGTATCCATCGG - Intergenic
938715802 2:134020663-134020685 CTGCTTTACCACGTATCTAGAGG + Intergenic
944939214 2:204605052-204605074 CTACTTTACAAGGTAACTCTGGG + Intronic
946746267 2:222848770-222848792 CTATGTTATCAGTTATCTATTGG - Intergenic
947045748 2:225981279-225981301 CTAGATTTCCAGGGATATATTGG - Intergenic
947491549 2:230599753-230599775 CTAGTTGACCATGTATATATGGG - Intergenic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1173721977 20:45267483-45267505 CAATTTTACCATGTATGTATGGG - Intergenic
1177646664 21:23907472-23907494 ATATTTTACAAGGTAGCTATAGG - Intergenic
950920651 3:16690686-16690708 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
955091213 3:55752455-55752477 CTGGTTTACCAGCGCTCTATTGG + Intronic
964880038 3:161413162-161413184 CTAGTTTATCATGTATCCAAAGG + Intergenic
965036048 3:163439424-163439446 GTAATTTACCAGGGATATATTGG + Intergenic
965962873 3:174449624-174449646 ATAGTTTACAAGATATCTTTAGG + Intronic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
971165149 4:24175188-24175210 CTAGTCTATCAGGTAATTATGGG + Intergenic
972282557 4:37617070-37617092 CTAGATTAGCATGAATCTATTGG - Intronic
972882143 4:43438059-43438081 CTTGTTCACCATGAATCTATTGG - Intergenic
975663927 4:76715273-76715295 CTCATTTCCCAGGTATATATAGG + Intronic
977578202 4:98697077-98697099 CTAGTTTTTCAGGTTTCTTTAGG - Intergenic
982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG + Intronic
983778852 4:171643024-171643046 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
987144894 5:14982520-14982542 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
989621575 5:43389662-43389684 CCAGTTTACTAAGTATATATAGG - Intronic
990724021 5:58733456-58733478 CTAATTTGCCAGATATCTATTGG + Intronic
990994650 5:61719511-61719533 ATACTATCCCAGGTATCTATTGG - Intronic
992694181 5:79268395-79268417 CTATTTTAATAGGTATGTATTGG + Intronic
997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG + Exonic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1002869614 6:1155188-1155210 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1003444149 6:6169545-6169567 CTAGTTTTCCAGGGATTGATGGG - Intronic
1003706831 6:8541800-8541822 CTATTCTACCAGGTATGTTTTGG - Intergenic
1003992812 6:11503652-11503674 CTCATTTACCAGGTAAGTATTGG + Intergenic
1004237492 6:13887302-13887324 CTACTTTACTAGGTAGCTGTGGG - Intergenic
1005164580 6:22905003-22905025 TTAGTTTATAAGCTATCTATGGG + Intergenic
1010952321 6:82051339-82051361 TCAGTTTACCATGTATATATAGG + Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1011326352 6:86152787-86152809 CTAGGTTCTCAGGTTTCTATAGG + Intergenic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1017574048 6:155781694-155781716 TTAGTTTCCCAGGTATTAATTGG - Intergenic
1018991840 6:168679705-168679727 CTAGTTTGTCAGGTTTCTTTGGG - Intergenic
1021602260 7:22376051-22376073 CTATTTTTCCTGGTGTCTATTGG - Intergenic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1022195238 7:28059185-28059207 TTAATTTACCAGGTTTCTTTTGG + Intronic
1024092352 7:45954444-45954466 CTCTATTACTAGGTATCTATTGG - Intergenic
1024092407 7:45955399-45955421 CTCTATTACTAGGTATCTATTGG - Intergenic
1025164559 7:56701462-56701484 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1025705718 7:63860614-63860636 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1026075316 7:67161447-67161469 TTAGATTACCACGTATCTTTTGG + Intronic
1026701534 7:72650756-72650778 TTAGATTACCACGTATCTTTTGG - Intronic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1030386898 7:108876368-108876390 CAAATTCACCAGGCATCTATTGG - Intergenic
1031188839 7:118519830-118519852 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1034403052 7:150878587-150878609 CTAGTTGCCCAGGAATCTAGTGG + Intergenic
1037390976 8:18391458-18391480 TTAGTTTTCCAGGTTTCTCTGGG - Intronic
1041425810 8:57719084-57719106 CTAGGTTACCAGTTTTCTAAGGG - Intergenic
1041750694 8:61257902-61257924 CTAGTTTACAAAATATGTATTGG + Intronic
1043255209 8:78127070-78127092 CAAGTTTACCAGGTAAATAAGGG - Intergenic
1043924535 8:86022014-86022036 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1044083303 8:87911756-87911778 CAAGTTTACCAGATAAATATAGG + Intergenic
1047544827 8:125805336-125805358 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1048621347 8:136136155-136136177 CTAGTTTATCAGGTTTGCATTGG - Intergenic
1051537502 9:18177158-18177180 CTAGTGTACCAAGTTTCTATGGG + Intergenic
1055108737 9:72538963-72538985 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1055233598 9:74091720-74091742 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1055547148 9:77390356-77390378 CTAGTTTAGCAGGAATCTCTTGG + Intronic
1056234722 9:84583261-84583283 ATATTTTACCAGGAGTCTATGGG - Intergenic
1057895016 9:98902299-98902321 CAAGCTAACCAGGCATCTATAGG - Intergenic
1062222883 9:135428054-135428076 CAAGTTTCCCAGGCATCTCTTGG - Intergenic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1197836281 X:130697211-130697233 CTAGGTGTCCAGGTATATATAGG - Intronic
1199178493 X:144822508-144822530 GTAGTCTACCAGGTCTATATAGG + Intergenic
1201412408 Y:13713430-13713452 CTAGTTTCTCCGGTATTTATAGG + Intergenic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic