ID: 928069871

View in Genome Browser
Species Human (GRCh38)
Location 2:28203940-28203962
Sequence AGTATTGGCAAGGATGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928069871 Original CRISPR AGTATTGGCAAGGATGTAGG AGG (reversed) Intronic
900381675 1:2387288-2387310 AGGGTTGGAAAGGAGGTAGGGGG - Intronic
901151135 1:7102584-7102606 TGTATGCGCAAGGATGGAGGAGG + Intronic
904920548 1:34004659-34004681 ACTATTGGTTAGGGTGTAGGAGG + Intronic
904974247 1:34443556-34443578 AGTATTGGCCATGATGAAGATGG - Intergenic
905161243 1:36036647-36036669 AGTATTGACCTGGATGAAGGTGG - Intronic
906608852 1:47188684-47188706 AATATTGGGAAGGAGGAAGGAGG + Intronic
907901655 1:58746968-58746990 AGTGTTTACAAGGATGTGGGTGG - Intergenic
908539929 1:65112551-65112573 AGTATTGGCCAGGGTGAGGGTGG + Intergenic
908636951 1:66177503-66177525 AGTATTCTCAAGGAGGTAAGAGG - Intronic
910844120 1:91588703-91588725 TGGATTTGCAAGTATGTAGGAGG - Intergenic
913107501 1:115628111-115628133 AGTATTTGCCATGAGGTAGGAGG - Intergenic
913991864 1:143620503-143620525 AGTATTGGGAACGCTGAAGGTGG - Intergenic
915770389 1:158416342-158416364 AGGATTGGCATGGATGTGGCTGG - Intergenic
916645060 1:166776592-166776614 AGTGTTAGAGAGGATGTAGGAGG + Intergenic
918606360 1:186431759-186431781 AGTAATGGCAAAGATGTGGAAGG + Intergenic
919418426 1:197340742-197340764 AGTTTTGGCAGGGATGGGGGTGG + Intronic
921169158 1:212530524-212530546 AGAAATGGAAAGGAGGTAGGTGG + Intergenic
921412477 1:214850526-214850548 AGTGTTGGGAGGGATGGAGGAGG - Intergenic
921764459 1:218953960-218953982 GTTATTGCCAAGGAGGTAGGGGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1066532942 10:36360337-36360359 ATTATGGGTAAGGATGTATGGGG - Intergenic
1068918935 10:62463048-62463070 AGTATTGGCAAGGATAGATCAGG - Intronic
1074221781 10:111445058-111445080 AGGATTGGAAAGAATGTAAGAGG - Intergenic
1075277815 10:121110892-121110914 ATTATTGGCAAGCATGAAAGGGG + Intergenic
1075470395 10:122684533-122684555 AGGATTGGCAAGGATCTCAGAGG - Intergenic
1075680368 10:124326880-124326902 AGTATTGGAAAGGTGGTGGGAGG - Intergenic
1080111842 11:28576600-28576622 AAAATAGGCAAGGAAGTAGGAGG - Intergenic
1080405187 11:31972323-31972345 GGTAATGGCAAGGAAGTGGGGGG + Intronic
1081435608 11:43024300-43024322 AGTATAGGTGGGGATGTAGGGGG - Intergenic
1085524421 11:77156013-77156035 AGCAATGGCAAAGATGTGGGGGG - Exonic
1087942324 11:104113322-104113344 TGCATTGGCAAGGATGGGGGAGG + Intronic
1088644537 11:111906888-111906910 ACTGTTGGCAAGGCTGAAGGTGG + Intergenic
1090164148 11:124529310-124529332 AGTATTTGGAAAGATGTATGTGG - Intergenic
1091152273 11:133339825-133339847 AGTATTGGCAAGATTCTACGAGG - Intronic
1091679599 12:2517406-2517428 AGTATTGGCATTGCTGTAGAAGG - Intronic
1091799179 12:3313944-3313966 AGTAATGGGAAGGGTGGAGGGGG - Intergenic
1093606278 12:21093164-21093186 AGTCTTGGCAAGGATTTATTAGG - Intronic
1093763230 12:22934018-22934040 AGTAGTGGCAAAGTTGTGGGGGG - Intergenic
1095163053 12:38939149-38939171 ATTATTATCATGGATGTAGGGGG + Intergenic
1105659093 13:22473025-22473047 ACTCTTGGCACTGATGTAGGAGG + Intergenic
1106404007 13:29457783-29457805 AATGTTGGCAAGAATGTAGAGGG - Intronic
1106761767 13:32874999-32875021 AGAAGTGGCAAGTATGTAGGAGG + Intergenic
1107608837 13:42092091-42092113 AGTTTTGGCAAGGATGTAAGGGG + Intronic
1110357274 13:74581878-74581900 AGTATTGGCAAGGATGAAACAGG + Intergenic
1115019516 14:28659358-28659380 AGTATTGGCAAGGATGAAAAGGG + Intergenic
1115574421 14:34696623-34696645 AGAATTGTCAAAGAGGTAGGAGG - Intergenic
1116005009 14:39283335-39283357 ACTACTGGCAGGGATGTAGATGG - Intronic
1119150975 14:72358921-72358943 AGTCTTGGGAAGGATGCAGTGGG + Intronic
1120510991 14:85414319-85414341 AGCAATTGCAAGAATGTAGGAGG - Intergenic
1122489917 14:102107686-102107708 AGTACTAGCAAGGATGCTGGTGG + Intronic
1124097071 15:26658662-26658684 AGTATTGGCAGGAATGATGGAGG - Intronic
1124906569 15:33874040-33874062 AGTATTGGGAAGGATGGGGAGGG - Intronic
1125318471 15:38457580-38457602 AGTAATGGCAAGGGTGCAAGGGG + Intronic
1127598138 15:60507768-60507790 AGTCTTCGCAGGGAAGTAGGGGG + Intronic
1127675232 15:61231945-61231967 GGGATTGGCAAGGAGGTAGGGGG - Intergenic
1128352456 15:66900223-66900245 AGTATTGCCAACGAGGGAGGAGG - Intergenic
1128538985 15:68511821-68511843 TGTATTGGCAAGGAGGTCGTTGG + Intergenic
1129573418 15:76715173-76715195 AGTATTGGCGGGGGTGTATGTGG - Intronic
1132612308 16:823364-823386 AGGATTCTCAAGGCTGTAGGAGG + Intergenic
1133517196 16:6520923-6520945 AGTGTTGGAAAGAGTGTAGGGGG + Intronic
1134556701 16:15171892-15171914 AGAAGTGGCAAGGAGGTTGGTGG - Intergenic
1134917282 16:18083605-18083627 AGAAGTGGCAAGGAGGTTGGTGG - Intergenic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138732857 16:59215169-59215191 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1140519345 16:75567934-75567956 AGTGTGGGCAAGGAGGTGGGTGG - Intronic
1141070260 16:80948210-80948232 TGCACTGGCAAGGATGTAGAGGG - Intergenic
1141405686 16:83790906-83790928 AGTATTAGCAAGAATGTAAAAGG + Intronic
1141415715 16:83871528-83871550 AGTGTTAGCAAGGATGCAGAGGG - Intergenic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1142794208 17:2294706-2294728 ACTTTTGCCAAGGATGTTGGGGG - Intronic
1145819468 17:27820986-27821008 AGTAGTGGCAGGGAGGTATGAGG + Intronic
1154236717 18:12612780-12612802 AGTATTGGCAGGCCTGGAGGTGG - Intronic
1156413318 18:36858247-36858269 AATATTAGCAGGGATGAAGGGGG - Intronic
1161237579 19:3205461-3205483 AGTCCTGGAAAGGATGGAGGTGG + Intronic
1162088699 19:8263523-8263545 AGTATTGGAGAGAATGTGGGGGG + Intronic
1163939884 19:20481805-20481827 AATATTGGAAAGGAGGTGGGAGG + Intergenic
1166117889 19:40667097-40667119 AGTGTTGGACAGGATGGAGGGGG - Exonic
1166332718 19:42088175-42088197 AATATTGGGAAGGGGGTAGGAGG - Intronic
1167295373 19:48646325-48646347 AGGATTCGGAAGGAGGTAGGGGG + Intergenic
926264639 2:11304333-11304355 AGTATTTGCAAGGATGGAATTGG - Intronic
926348285 2:11969805-11969827 GATGTTGGCAAGGATGTGGGAGG - Intergenic
926965086 2:18401119-18401141 AGTATGGGCACTGATATAGGAGG + Intergenic
928069871 2:28203940-28203962 AGTATTGGCAAGGATGTAGGAGG - Intronic
928485279 2:31724715-31724737 GGTATTGGAAAAGATGTTGGAGG + Intergenic
932278586 2:70470373-70470395 AGTCTTAGCAAGGATGTATAAGG + Intronic
933153031 2:78937566-78937588 AGGATTGGCAAGGATGTTACAGG - Intergenic
934782434 2:96979985-96980007 AGTATTGACAAGGATGGAACAGG - Intronic
934926418 2:98384777-98384799 GGTGTGGGCAAGGATGTGGGTGG + Intronic
938215232 2:129506289-129506311 AGTATGGGGAAGGATGGATGGGG - Intergenic
938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG + Intronic
939552048 2:143627452-143627474 ACCATTGCCAAGGATCTAGGTGG - Intronic
941046185 2:160678190-160678212 AGTGTTGGCAAGCATGTAATGGG - Intergenic
941355268 2:164483189-164483211 AGTATTGTTAAGGGTGTGGGGGG - Intergenic
941408501 2:165122495-165122517 AATATAGTCAGGGATGTAGGAGG - Intronic
942361803 2:175181004-175181026 AGTACTGCAGAGGATGTAGGGGG - Intronic
945493831 2:210485909-210485931 AGTATTGACAAGTAAGTACGTGG - Intronic
945537786 2:211040596-211040618 AGTATTAGAAAGCCTGTAGGAGG + Intergenic
946889353 2:224259382-224259404 AGTAGTGGCAAGGATGTGTGGGG + Intergenic
947849263 2:233271906-233271928 ATTCTTGGCCAGGATGTAGAAGG - Intronic
948554985 2:238803114-238803136 ACTCTTGCCAAGGATCTAGGAGG - Intergenic
1170458824 20:16557791-16557813 AATATTGGCAAGGATTTTAGCGG - Intronic
1171724093 20:28599543-28599565 ACTCTTGGCAAGGATGTAACTGG + Intergenic
1174280608 20:49436178-49436200 AGTGCTGGCAAGGATGTAGAGGG + Intronic
1174871098 20:54183128-54183150 AGTGTTGGGGAGGATGTAGAGGG - Intergenic
1175596640 20:60239838-60239860 AGTCGTGGCAAGGATGCAGGTGG - Intergenic
1176113307 20:63420464-63420486 AGCAGTGGCAAGGAGGTTGGGGG - Intronic
1178586064 21:33872153-33872175 AGTGTTGGCAAAGATCTGGGTGG + Intronic
1180297645 22:10958219-10958241 ACTCTTGGCAAGGATGTAACTGG + Intergenic
1181898320 22:26130722-26130744 AGTGTTGGCGAGGATGTGGAGGG - Intergenic
1183135922 22:35887600-35887622 AGTATTGGGAAGGAAGGAAGAGG - Intronic
949103508 3:175324-175346 AATATGGGCAAAGATGTATGTGG - Intergenic
951487908 3:23234647-23234669 AGGCTTGGGAAGGAGGTAGGGGG + Intronic
954767629 3:52934186-52934208 AGTGTTGGCAAGGAAGTAGAGGG + Intronic
956006679 3:64787034-64787056 AGTGTTGGCAAGGATGCAACTGG + Intergenic
960048177 3:113217009-113217031 AGTATTGGACAAGATGAAGGTGG + Intronic
960102504 3:113759800-113759822 AGTACTGGCAAGGGTGTGGGGGG - Intronic
964751382 3:160057140-160057162 AGTATAGGGAAGGATGTACATGG + Intergenic
966027886 3:175308411-175308433 AGCAATGGAAAGGAGGTAGGGGG + Intronic
966216012 3:177503421-177503443 AGCTTTGGCAAGGATGTACATGG + Intergenic
970682820 4:18530792-18530814 AGTATTGGCAAGGATGCATTAGG - Intergenic
970979780 4:22082746-22082768 AGGATAGGAAAGGAAGTAGGTGG - Intergenic
971589522 4:28449606-28449628 AGTTTTGTCAAGGATGTTGTAGG - Intergenic
976679405 4:87738618-87738640 CCTGTTTGCAAGGATGTAGGAGG + Intergenic
977648345 4:99439863-99439885 AGTATTTGCAAGGATGGGCGAGG + Intergenic
978632680 4:110765335-110765357 TGTATTGGCATGGATGTTTGAGG + Intergenic
978981645 4:114954896-114954918 AGCAGTAGCAAGGATGTGGGAGG - Intronic
979488686 4:121298826-121298848 AGTAGTAGCATGGAGGTAGGAGG - Intergenic
981903175 4:149890242-149890264 ACTTTTGGCAGGAATGTAGGAGG + Intergenic
981958992 4:150512995-150513017 AGTATAGGTAAGGAAGTAAGTGG + Intronic
982155842 4:152520093-152520115 AGAATTGGCAAGGAAGGAGAGGG - Intronic
984265538 4:177494868-177494890 AGTATTGGCAAATATGAAGAGGG + Intergenic
985437415 4:189944086-189944108 ACTCTTGGCAAGGATGTAACTGG - Intronic
985570952 5:644625-644647 AGTCCTGGCATGGATGTAGGAGG + Intronic
986131628 5:4937221-4937243 CTTATTCACAAGGATGTAGGTGG - Intergenic
987396956 5:17433195-17433217 GGTGTTTGCAAGCATGTAGGTGG - Intergenic
988678390 5:33458064-33458086 GATGTTGGCAAGGAGGTAGGAGG + Intronic
991219993 5:64202611-64202633 AGTATTGGCAAAGATGTAACTGG - Intronic
993444665 5:87996289-87996311 AAAATTGGCAAGTGTGTAGGAGG + Intergenic
996585053 5:125078091-125078113 AGTGTTGGCGAGGCTGTTGGTGG + Intergenic
997359315 5:133284528-133284550 GATAATGGCAAGGATGTAGAGGG - Intronic
999873772 5:155779785-155779807 AGTGTTGGCAAGGATGCAGGAGG - Intergenic
1000688991 5:164291151-164291173 AGTATTGGCAATGATTTCAGAGG + Intergenic
1000987414 5:167875997-167876019 AGACTAGGCGAGGATGTAGGTGG - Exonic
1001144523 5:169172036-169172058 AGCTTTGGGAAGGAGGTAGGGGG + Intronic
1001334946 5:170789363-170789385 AGGATTGGCAATGATGGATGAGG + Intronic
1003525804 6:6895913-6895935 ACTATTGGCAATAATGTAAGTGG - Intergenic
1003829401 6:9990446-9990468 AGTGTCGGCAAGGATGAAGAGGG + Intronic
1006302516 6:33201096-33201118 AGTCTTGGGAACAATGTAGGTGG + Exonic
1008142085 6:47843706-47843728 AGAAAAGGCAAGGATGTAGAGGG - Intergenic
1008504626 6:52217782-52217804 AGTTTTGGCAAGGATATGAGAGG + Intergenic
1008822936 6:55655697-55655719 AGTGTTGGTAAGTATGAAGGTGG - Intergenic
1010075661 6:71794203-71794225 AGGACTGGCCAGGATGTAGATGG - Intergenic
1012218766 6:96622214-96622236 AGTATTGTTACGGATGTAGAGGG + Intergenic
1012351276 6:98253895-98253917 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1013251509 6:108338963-108338985 TGTATTAACAAAGATGTAGGGGG - Intronic
1015558937 6:134494104-134494126 AATATTGGCAAACATTTAGGAGG + Intergenic
1021340985 7:19462339-19462361 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1025152068 7:56564562-56564584 ACTATAGGCTAGGATGTGGGAGG - Intergenic
1026593702 7:71716811-71716833 AGCATTGGCAAAGAGGAAGGAGG - Intergenic
1027795972 7:82694469-82694491 AGTACTAGCAAGTATGAAGGAGG - Intergenic
1030257188 7:107523469-107523491 TGTGTTGGCATGGTTGTAGGGGG + Intronic
1032097672 7:128947585-128947607 AGGATTGGCAAGGAGGGTGGAGG + Intronic
1033022664 7:137742250-137742272 AGAATTGGAATGGAAGTAGGTGG - Intronic
1034479628 7:151309303-151309325 ACGATTGGCAAGGAGGTGGGAGG - Intergenic
1036959550 8:13228940-13228962 AGTGTTGGTAAGGATGTGGAGGG + Intronic
1038966583 8:32579852-32579874 AGTGTTGGCAGGGCTGCAGGAGG + Intronic
1039294182 8:36131431-36131453 AGTCTTGGCAAGGAAATAGAAGG - Intergenic
1039535427 8:38307339-38307361 ATTATTGATAAGGGTGTAGGGGG + Intronic
1039968014 8:42297946-42297968 AGTCCTGGCCAGGATGCAGGGGG - Intronic
1040846921 8:51853192-51853214 ATTTTTGGCAAGGGTGTAGGAGG + Intronic
1043218671 8:77629721-77629743 AGGAATGGCAAGTATGTAGCTGG - Intergenic
1043248421 8:78036476-78036498 AGTATTGATAAGACTGTAGGGGG - Intergenic
1045286109 8:100793087-100793109 GGTATTGGGTAGGAGGTAGGAGG - Intergenic
1045831206 8:106462911-106462933 ATTATTGGAAAGAATGTAGGTGG - Intronic
1046377193 8:113399186-113399208 AGTATTGGCAAGAATGTGGAGGG + Intronic
1046528597 8:115414448-115414470 AGTTTTGGCAAGGATTTGGTAGG + Exonic
1047055959 8:121165297-121165319 AACATTGGCAAGAAGGTAGGGGG - Intergenic
1047441871 8:124885773-124885795 AGAAGTGGCAAGGATGGGGGAGG - Intergenic
1049333273 8:142067103-142067125 AGCGCTGGCAAGGATGTGGGGGG + Intergenic
1050768261 9:9163503-9163525 AGTATTGGCTTGGATCTCGGTGG - Intronic
1051042872 9:12835584-12835606 AGAATTGGCAAGAAGGTTGGAGG + Intergenic
1051173775 9:14344719-14344741 AGTCTTGGCAACCCTGTAGGAGG - Intronic
1051608418 9:18938931-18938953 GGGGTTGGCAAGGATGGAGGAGG - Intronic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1053725509 9:40995525-40995547 ACTCTTGGCAAGGATGTAACTGG - Intergenic
1055460256 9:76512777-76512799 AGCATTGGCAAGAATGTGGTAGG - Intergenic
1055633498 9:78249303-78249325 AGAATTTGCAAGGAAGGAGGAGG - Intronic
1056680330 9:88711961-88711983 AATAATGGCAAGGATGATGGTGG + Intergenic
1056680336 9:88712000-88712022 AATAATGGCAAGGATGATGGTGG + Intergenic
1058103452 9:100942306-100942328 AGAATTGTCAAGGATGTGGGGGG - Intergenic
1060042442 9:120310884-120310906 AGTACTGTAAAGGATGTGGGTGG - Intergenic
1062305305 9:135902963-135902985 ATTCTTTGCAAGGATGTCGGCGG - Intronic
1203449300 Un_GL000219v1:96447-96469 ACTCTTGGCAAGGATGTAACTGG + Intergenic
1185853099 X:3507491-3507513 AGTAGGGGCAGGGGTGTAGGAGG + Intergenic
1186019929 X:5243042-5243064 TTTATTAGCAAGGAGGTAGGAGG + Intergenic
1186932820 X:14413489-14413511 AGTATTGGCAAGGATGTGAATGG - Intergenic
1189013813 X:37074940-37074962 AGTTTTGGCAAGGATGTTTAGGG + Intergenic
1189680590 X:43512228-43512250 AGTACTAGCAAGGGTGCAGGTGG + Intergenic
1193160028 X:78217422-78217444 AGTAATGGCAGGGCTGAAGGAGG + Intergenic
1194609196 X:96019779-96019801 ACTATTGGCAAGGATGTAATTGG + Intergenic
1195667065 X:107441089-107441111 GGTATGGGCAAGGAAGAAGGAGG + Intergenic
1196810124 X:119622259-119622281 AGTATCTGCAACGATGTAGGGGG + Intronic
1198400417 X:136263197-136263219 AGAATTGGCAGAGATGGAGGTGG - Intergenic
1200268372 X:154658874-154658896 AGAGTTGGGAAGGATGTAGCAGG + Intergenic
1201794110 Y:17876102-17876124 AGTATTTACAAAGATGTGGGTGG - Intergenic
1201807444 Y:18029883-18029905 AGTATTTACAAAGATGTGGGTGG + Intergenic
1202355491 Y:24043915-24043937 AGTATTTACAAAGATGTGGGTGG - Intergenic
1202515287 Y:25626194-25626216 AGTATTTACAAAGATGTGGGTGG + Intergenic