ID: 928070669

View in Genome Browser
Species Human (GRCh38)
Location 2:28212155-28212177
Sequence CTCAAGCTATTCCAACTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928070669_928070671 10 Left 928070669 2:28212155-28212177 CCTGTTAGTTGGAATAGCTTGAG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 928070671 2:28212188-28212210 ATTATTTTGGCCATTTTTTAAGG 0: 1
1: 0
2: 6
3: 119
4: 939
928070669_928070670 -3 Left 928070669 2:28212155-28212177 CCTGTTAGTTGGAATAGCTTGAG 0: 1
1: 0
2: 1
3: 7
4: 140
Right 928070670 2:28212175-28212197 GAGATATTTGCAAATTATTTTGG 0: 1
1: 0
2: 4
3: 51
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928070669 Original CRISPR CTCAAGCTATTCCAACTAAC AGG (reversed) Intronic
903094567 1:20957996-20958018 CTGAAACTATTCCAAGTGACTGG + Intronic
904203445 1:28836799-28836821 CTCAAGCAATCCCAAGTAGCTGG + Intronic
907116608 1:51974292-51974314 CTCAAGCTAGTTAAACTAAGTGG + Intronic
908955055 1:69614912-69614934 CACAACCTATCCCACCTAACAGG + Intronic
912280451 1:108307793-108307815 CTCAAGTTCTTTCAAATAACTGG - Intergenic
912287775 1:108386564-108386586 CTCAAGTTCTTTCAAATAACTGG + Intronic
912506966 1:110163057-110163079 CTCAAGCTATTCCAAACATGAGG + Intronic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
917564124 1:176194326-176194348 GTCCAGCTAATCCAACTAAAAGG + Intronic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
919434759 1:197544316-197544338 CTCAAGCCATTCCTATTAATTGG - Intronic
921401816 1:214732325-214732347 CTCAAGCAAATCAATCTAACAGG - Intergenic
922084692 1:222335061-222335083 CTCAAGTTGTCCCAACTTACTGG - Intergenic
1063843988 10:10104617-10104639 CTCAAGCTATTTCAACCCAAGGG - Intergenic
1065137493 10:22686405-22686427 CTCAACCTAGTATAACTAACAGG - Intronic
1067826003 10:49573400-49573422 CTCAAGCCATTCCGAGTAGCTGG - Intergenic
1067826173 10:49574866-49574888 CTCAAGCCATCCCAAGTAGCTGG - Intergenic
1070745419 10:78930864-78930886 CTCAAGCTGTTCCATCCATCTGG + Intergenic
1071196281 10:83163950-83163972 CTCAAGCTTTGCCAAGTATCTGG - Intergenic
1072182756 10:93003494-93003516 CTCAAGCTAATTTAACTCACAGG - Intronic
1072296185 10:94011520-94011542 CTCCAGCTCTTCCAGCTTACTGG - Intronic
1072334009 10:94381263-94381285 CTAAAAATATACCAACTAACAGG + Intergenic
1074215545 10:111380697-111380719 CTCAATCTATTCTATCTCACTGG - Intergenic
1077575032 11:3376434-3376456 CTCAAGCTTGTCCAACCCACAGG - Intronic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1081085270 11:38791727-38791749 CCCAAGCTGTTCCCACTAGCTGG + Intergenic
1081947807 11:47014092-47014114 CTCAAGCCATACCAAGTAGCTGG - Intronic
1082948287 11:58784035-58784057 CTCCAGGTTTTCCAACTTACTGG - Intergenic
1088153792 11:106780060-106780082 CTCTAGCAATTCCAAGTAGCTGG - Intronic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1094642555 12:32290206-32290228 CTGAAGCTATACAAACTAATTGG - Intronic
1096403392 12:51325245-51325267 CTCAAGCTATCCCCTCAAACAGG - Intergenic
1097268805 12:57761611-57761633 CTCACCCTATTCCAATTAGCTGG - Intergenic
1099849842 12:88079483-88079505 ATCAAGCTATTACAAAAAACAGG + Intronic
1100882423 12:99033898-99033920 CTCAAGCTTTTTCTACTAATAGG - Intronic
1109034536 13:57238454-57238476 CTCAAGCTGTGTCAACTAGCAGG + Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1111771568 13:92602979-92603001 CACATGCTATCCCAACTTACCGG - Intronic
1112860710 13:103826818-103826840 CTGAAACTATTCCAAATAATAGG - Intergenic
1113241537 13:108343973-108343995 ATGATGCTATTCCAGCTAACAGG - Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116460475 14:45166987-45167009 ATAAAGCTATTTCAAGTAACAGG + Exonic
1118189396 14:63566919-63566941 CTCAAGCTTTTGTAACGAACGGG - Intergenic
1119127596 14:72142128-72142150 CTTAAGCTAGTACAATTAACAGG - Intronic
1119457234 14:74766583-74766605 CTCAAGCCATCCCAAGTAGCTGG + Intronic
1124661137 15:31551914-31551936 CTCAAACTATATCAACTACCAGG - Intronic
1128360241 15:66956804-66956826 CTCAGGCTATTCCTACTATCAGG + Intergenic
1131556845 15:93407072-93407094 CTCAGGATATTCCAACTATCAGG + Intergenic
1140524733 16:75613178-75613200 CTCCAGAAATTCCAACTCACTGG - Intronic
1142597099 17:1035268-1035290 CTCAGGCTATCCCAACCACCTGG + Intronic
1146398067 17:32484447-32484469 TTCTAGCTATTCCAATTCACGGG - Intergenic
1150818694 17:68417189-68417211 CTCTAGCTGTTCCACCTAAGGGG - Intronic
1151030587 17:70733556-70733578 CTCCAGCAATCCCAGCTAACTGG - Intergenic
1152553771 17:81042980-81043002 CTCAAGCAATTCCAAGAAGCTGG + Intronic
1156791029 18:40975491-40975513 CACAAGCTAATCCAAAAAACTGG - Intergenic
1160863336 19:1246789-1246811 CTCAAGCCATTCCCACTTCCTGG + Intergenic
1162441153 19:10692908-10692930 CTCAAGCTATTCCCTCTGCCTGG - Intergenic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1166047776 19:40239578-40239600 CTCAATCTAGTCCATTTAACTGG + Intronic
1166782369 19:45349270-45349292 CACAAGTTATACCATCTAACGGG - Intronic
926638483 2:15209177-15209199 CTCTAGATTTTCCAACTTACTGG - Intronic
928070669 2:28212155-28212177 CTCAAGCTATTCCAACTAACAGG - Intronic
929315864 2:40477835-40477857 ATCAAGCTATGCTAACTAAGAGG - Intronic
929798978 2:45083296-45083318 GTCAAACTATTCCTTCTAACTGG - Intergenic
930114623 2:47707950-47707972 CTCAAGCTGTTCCCACTGCCTGG - Intronic
931330975 2:61282857-61282879 CTCAAGCCCTTCCTACTACCTGG + Intronic
932129247 2:69172933-69172955 CTCCAGTTACTCCAAATAACTGG + Intronic
933884237 2:86703001-86703023 CTCAAGCTACTTCATCTATCAGG - Intronic
935069214 2:99678979-99679001 CTCATGCCATCCCAGCTAACTGG + Intronic
935402460 2:102674592-102674614 CTCAAGTTATGTCAAATAACGGG - Intronic
939026493 2:137020212-137020234 CTCAAGCTATTCCTGCTGCCTGG - Intronic
941546734 2:166860223-166860245 TTCATACTATTGCAACTAACAGG - Intergenic
944393277 2:199242132-199242154 CTGAAACTATTCCAATCAACAGG - Intergenic
945490487 2:210448952-210448974 CTGAAACTATTCCAAACAACAGG + Intronic
947138404 2:226997935-226997957 CTAAAGTTATGCCAACAAACTGG + Exonic
1169490885 20:6070629-6070651 CTCAAGCGATTCCCAGTAGCTGG + Intergenic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1176652301 21:9561761-9561783 GACAAGATATTACAACTAACAGG - Intergenic
1177541321 21:22497077-22497099 CTAAAACTATTCCAAACAACAGG + Intergenic
1178000612 21:28158528-28158550 CTCCAGAAATTCCAACCAACTGG + Intergenic
949114578 3:304285-304307 CTGAAACTATTCCAAACAACAGG - Intronic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
952300925 3:32104187-32104209 CTCAGCCTATTCCGACTAGCTGG + Intergenic
952388071 3:32857230-32857252 CTCAAGCTGTTCCTTTTAACTGG + Intronic
952637993 3:35554911-35554933 CTCAAGCTATTCTTGCTAGCTGG + Intergenic
953368374 3:42366486-42366508 CTCAAGCTGTTCCCACTGCCTGG + Intergenic
955077953 3:55631523-55631545 CTCTAGCTCTGCCAACTAAATGG + Intronic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
962217513 3:133535422-133535444 TTCAAGCTATTCCTACTTCCAGG - Intergenic
963224969 3:142853223-142853245 CACAAGCTATTCCTTCTACCTGG + Intronic
964437204 3:156666373-156666395 CACATGCTATTCCATCTACCTGG + Intergenic
967441444 3:189513678-189513700 CTCCAGCTTTGCAAACTAACGGG - Intergenic
967645222 3:191914720-191914742 CTCAAAGTTTTTCAACTAACTGG + Intergenic
968558508 4:1263313-1263335 CCCATGCTAGTACAACTAACTGG - Intergenic
971466845 4:26972784-26972806 CTGAAACTATTCCAATCAACAGG - Intronic
972241124 4:37193544-37193566 ATCAAGCTATTATAACAAACGGG + Intergenic
973561236 4:52138393-52138415 CTCATACTATTCTAACTTACAGG + Intergenic
974751704 4:66150458-66150480 CTCAAGCTGTTCTAAGTATCAGG + Intergenic
976757010 4:88509465-88509487 CTCAGGCTTCTCCAACTTACAGG + Intergenic
977994780 4:103488348-103488370 CTGAAGCTATTCCAAATAATAGG + Intergenic
978361795 4:107938655-107938677 CTCAAGCTAGTTCATCAAACAGG - Intronic
979275072 4:118806432-118806454 CTCAAGCCATTCCGAGTAGCTGG + Intronic
979291942 4:118988135-118988157 CTCTAGCTATTCAAATAAACAGG - Intronic
979658685 4:123226754-123226776 CTGAAACTATTCCAATCAACAGG - Intronic
979676846 4:123419143-123419165 CTGAAGCTATTTTAACAAACAGG - Intergenic
980336200 4:131476749-131476771 CTGAAACTATTCCAAACAACAGG + Intergenic
984871253 4:184327198-184327220 TTCCAGCTATTCCACCCAACTGG - Intergenic
984975498 4:185227022-185227044 CGCAAGCTCTTCCGACTCACGGG - Intronic
990313609 5:54563794-54563816 CTCAAGCTATTTCAAATAGAAGG - Intergenic
995968981 5:117943900-117943922 CTCAAGCTATTACTAGGAACAGG - Intergenic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
997058751 5:130476630-130476652 CTCAAGCTATGCAAACTTCCCGG + Intergenic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
1003954315 6:11147834-11147856 TTCAAGCAATTCCAAGTAGCTGG - Intergenic
1004983747 6:21057066-21057088 CTGAAACTATTCCAAACAACTGG - Intronic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1014520146 6:122432867-122432889 TTAAAACTAGTCCAACTAACTGG - Exonic
1022050387 7:26662899-26662921 CTCAGGCTATTCCAAGGAGCTGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1025547525 7:62195962-62195984 CTGAAACTATTCCAATCAACAGG - Intergenic
1025908099 7:65804665-65804687 CTCATGCTATTCCTTCTATCAGG - Intergenic
1028247283 7:88495706-88495728 CTCAAACTATCCCAACTTATGGG - Intergenic
1032134536 7:129263537-129263559 CTCAAGCTACTTCAAGTCACTGG - Intronic
1044372840 8:91433696-91433718 CTCCAGCTATTGCAAATGACAGG + Intergenic
1046853620 8:119004248-119004270 TTTTAGCTATTCCAACTATCAGG + Intronic
1048414772 8:134214059-134214081 ATAAAACTATTCCAACTAATAGG - Intergenic
1050517283 9:6458051-6458073 CTGAAACTATTCCAAACAACAGG - Intronic
1052667681 9:31515920-31515942 CTGAAACTATTCCAAATAATAGG - Intergenic
1053141900 9:35687847-35687869 CTCAAGCTCTTCCCAGTTACGGG + Intronic
1053295390 9:36909450-36909472 CTCAAGCTATTCTACCTGCCTGG - Intronic
1054764497 9:69032239-69032261 CTACAACTATTCCAACCAACAGG - Intergenic
1056003200 9:82239543-82239565 CTCAAACTATTCCAAACAAGAGG - Intergenic
1059653965 9:116340338-116340360 CACAACCTTGTCCAACTAACAGG + Intronic
1059999342 9:119944140-119944162 CTCAAGCTATTTCAAAGAAGAGG - Intergenic
1203630030 Un_KI270750v1:65307-65329 GACAAGATATTACAACTAACAGG - Intergenic
1186883857 X:13892928-13892950 CTCAAGCAATCCCAAGTAGCTGG - Intronic
1187249853 X:17587210-17587232 TTCAATTTATTCCAACTAATTGG - Intronic
1188393379 X:29649195-29649217 CTCAAGCTATTACAAAAAATTGG + Intronic
1192133894 X:68578816-68578838 CTGAAACTATTCCAATCAACAGG - Intergenic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1196541446 X:116913740-116913762 CTTAATCTATTCAAACTACCTGG + Intergenic
1198538015 X:137605541-137605563 CTCTAGCTTTTCCAACTTGCTGG - Intergenic
1202044159 Y:20720837-20720859 CTGAAACTATTCCAATCAACAGG + Intergenic
1202241566 Y:22775831-22775853 CTGAAGTTATTCCAATCAACAGG - Intergenic
1202394549 Y:24409574-24409596 CTGAAGTTATTCCAATCAACAGG - Intergenic
1202476235 Y:25260518-25260540 CTGAAGTTATTCCAATCAACAGG + Intergenic