ID: 928074102

View in Genome Browser
Species Human (GRCh38)
Location 2:28247282-28247304
Sequence CTGTGAGTTAGTGAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928074102 Original CRISPR CTGTGAGTTAGTGAGGGAGC AGG (reversed) Intronic
900339846 1:2182875-2182897 CAGTGAATGAGTGAGTGAGCAGG + Intronic
900691337 1:3982314-3982336 CTTTCAGGAAGTGAGGGAGCTGG + Intergenic
902693872 1:18127303-18127325 CTGTGGGATAGTGAGGGACTCGG + Intronic
902777780 1:18685650-18685672 CTGTGAGTGAGTGAGCCAGGTGG - Intronic
903051782 1:20606445-20606467 CTGGGAGTTAGTGCCAGAGCTGG + Intronic
903491891 1:23735445-23735467 CAGTGAGTTAGGGATGGAGGAGG + Intergenic
903866092 1:26399044-26399066 CAGTGAGTTAGTGACAAAGCTGG + Intergenic
905008713 1:34732017-34732039 CTGTGAGATGGAGAGGGAGGAGG + Intronic
905386695 1:37609371-37609393 CGGTGAGTTAAAGAAGGAGCAGG - Intergenic
906403781 1:45525164-45525186 AAGGGAGTTAGTGAGGGAGCTGG - Intergenic
906745727 1:48221069-48221091 CTGGGTGTTAATCAGGGAGCAGG - Intergenic
906802312 1:48748860-48748882 CTGTGAGTGAGGGCAGGAGCAGG + Intronic
907325561 1:53636730-53636752 GAGTGACTGAGTGAGGGAGCAGG - Intronic
907400239 1:54220745-54220767 CAGTGAGCTGGTGAAGGAGCAGG + Intronic
910387416 1:86700566-86700588 CTGGGAGAGAGTGAGGGAGCTGG + Intergenic
911571954 1:99528268-99528290 CTGTTAGTTCATGTGGGAGCTGG - Intergenic
911858186 1:102909190-102909212 CTGTTAGTTCCTGAGAGAGCTGG + Intronic
916325603 1:163556411-163556433 CTGTGATTAAGGGAAGGAGCAGG - Intergenic
916851797 1:168711697-168711719 CTGTTAGTTGGTGAGGAGGCTGG + Intronic
917074295 1:171187811-171187833 CTCAGAGTTAATGAGGGAGAAGG + Intronic
917320954 1:173780985-173781007 CTGTGAGTGAGAGAGAGAGAGGG + Intronic
917838926 1:178962052-178962074 CTGTGAGTTACTGAGATAGTGGG - Intergenic
919785188 1:201254185-201254207 CGGTGAGTTAGTGCCAGAGCTGG + Intergenic
920974092 1:210769461-210769483 TAGTGAGTTTGGGAGGGAGCTGG - Intronic
922331355 1:224579710-224579732 CTGTTAGTTCCTGAGAGAGCTGG + Intronic
922467348 1:225853427-225853449 CTGTGAGCTAGAGAGGAGGCTGG + Intronic
923465293 1:234243002-234243024 CTATGAATTAGTGGGGGAGTAGG + Intronic
924021601 1:239789644-239789666 CTCTTAGTTCCTGAGGGAGCTGG - Intronic
1064388739 10:14922740-14922762 CTGTTAGTAAGTGGCGGAGCTGG + Intronic
1065381615 10:25096543-25096565 CGGTGAGTTAGTGGGGTGGCAGG - Intergenic
1065667764 10:28081288-28081310 GTGTGGGTGAGGGAGGGAGCAGG - Intronic
1066565006 10:36712516-36712538 CTGAGAGCTACTGAGGCAGCCGG + Intergenic
1070620966 10:78010688-78010710 CTGGGAGTTAGTGACAAAGCTGG - Intronic
1070779764 10:79130661-79130683 CGGTTAGTCAGTGATGGAGCCGG - Intronic
1070814141 10:79312638-79312660 TTGTGAGTTCGGGAAGGAGCTGG - Exonic
1071268471 10:83985199-83985221 CTGTGAGTTCATGTGAGAGCTGG - Intergenic
1073449075 10:103598884-103598906 CTGTGAGTTAGGGGGTGAGGGGG + Exonic
1074209501 10:111316862-111316884 CTGTGAGTTTGTGTGGCTGCAGG - Intergenic
1074567102 10:114589929-114589951 ATGTGAGTCAGTGAGTGAGTGGG - Intronic
1074685713 10:115960752-115960774 CTGTGTGTGTGTGAGGGAGGAGG - Intergenic
1076158130 10:128219431-128219453 GTGTGAGTGAGTGAGTGAGTGGG - Intergenic
1076532809 10:131155867-131155889 GTGTGGTTTAGTGAGGGAGGAGG - Intronic
1076978991 11:195427-195449 GTGTGAGTCAGTGTGGGCGCTGG - Intronic
1077237928 11:1491258-1491280 CTGTGCCTTTGTGAGGGTGCCGG - Intronic
1077401866 11:2362831-2362853 CTGTGAGAGAGGGAAGGAGCAGG - Intergenic
1079680951 11:23297832-23297854 GGGTGAGTTAGTGAGTGAGTGGG - Intergenic
1082185832 11:49180127-49180149 CAGAGAGTAAGTGAGAGAGCCGG - Intronic
1082916834 11:58446482-58446504 CTTTCAGTTTGTGTGGGAGCTGG + Intergenic
1083741603 11:64714221-64714243 CTTTGAGAGGGTGAGGGAGCGGG - Intronic
1083802560 11:65054758-65054780 CTGTGTGTAAGGGAGGGACCGGG + Intronic
1083826315 11:65205905-65205927 CAGGTAGTCAGTGAGGGAGCTGG + Intronic
1083828336 11:65215768-65215790 GAGTGAGTGAGTGAGTGAGCAGG + Intergenic
1083828342 11:65215840-65215862 TAGTGAGTGAGTGAGTGAGCCGG + Intergenic
1083828464 11:65216531-65216553 CGGTGAGTGAGTGAGTGAGTGGG + Intergenic
1083987064 11:66222440-66222462 CTGTGATCTGCTGAGGGAGCAGG - Intronic
1084367667 11:68713239-68713261 TTGTTAGTGAGTTAGGGAGCTGG + Intronic
1084599528 11:70136593-70136615 CTGTGAGCAAGTGAGGGCCCAGG + Intronic
1084968352 11:72756058-72756080 GTGTGATTGAGTGAGGCAGCAGG - Intronic
1085247047 11:75110278-75110300 CTGTAAGGGAGTGAGGGAGGTGG + Intronic
1085393175 11:76192971-76192993 AAGTGAGTTAGTGGGGGAGCTGG + Intronic
1087022257 11:93615392-93615414 CTGTGAGTGTTTGAGGGAGTGGG - Intergenic
1087132372 11:94679278-94679300 CTGAGTGTTTGGGAGGGAGCTGG - Intergenic
1087833050 11:102840486-102840508 CTGTGAGTGAGTGATAGAGTGGG + Exonic
1087939006 11:104071024-104071046 TAGTGAGGCAGTGAGGGAGCAGG - Intronic
1088820573 11:113453092-113453114 CTGTGGCTTAGAGAGGGAGATGG - Intronic
1089996935 11:122917297-122917319 CAGTGAGTTAGTTAAGGAGAAGG + Intronic
1090411989 11:126515664-126515686 CTGCTTGTTAGTGCGGGAGCAGG + Intronic
1091326951 11:134698370-134698392 CTGTGAGGAGGTGAGGCAGCTGG - Intergenic
1091403143 12:193043-193065 CTGTGAGGAAGGGATGGAGCCGG + Intronic
1091884954 12:4010011-4010033 CAGTGAGTTAGTGGCAGAGCAGG - Intergenic
1094177518 12:27556587-27556609 TTGTCAGTTACTGAGGGAACAGG + Intronic
1095683246 12:45003089-45003111 CTGTGAGTGAGAGGGAGAGCAGG - Intergenic
1097129827 12:56803900-56803922 GTGTGAGTGAGTGTGGGATCCGG + Intergenic
1097677639 12:62620187-62620209 TTGTGAGGGAGGGAGGGAGCTGG - Intergenic
1097684464 12:62678595-62678617 CTGAGAGTTAGAGATGGAGATGG + Intronic
1101965382 12:109278917-109278939 CTGGGAGGTAGGGAGGGAGAAGG + Exonic
1104170370 12:126274794-126274816 CTGTCACTTAGTGAGGGACAAGG - Intergenic
1105009560 12:132746433-132746455 CTGTGAGTTAGGGAAGGAGGAGG - Intronic
1107760128 13:43669404-43669426 CTTGGAGGTAGTGAGGGAGAAGG - Intronic
1111937124 13:94569179-94569201 ATGGGAGTTAGTGAGGAAACAGG - Intergenic
1112262091 13:97886229-97886251 CTGTGAGGCAGGGAGGGAGAAGG + Intergenic
1114344650 14:21781834-21781856 ATGTGAGTTAGTGAAGGGTCCGG - Intergenic
1114512562 14:23274940-23274962 CTGTGATTTAGTCATGAAGCGGG + Exonic
1115810168 14:37098430-37098452 CAGTGAGTTAGTGGCAGAGCTGG - Intronic
1115904203 14:38189016-38189038 CTGTGAGTTAAGGAAAGAGCTGG + Intergenic
1117176585 14:53152609-53152631 CTATGAGGTAGTGACGGAGCTGG - Exonic
1117484484 14:56180752-56180774 ATGAGAGTTTGAGAGGGAGCAGG - Intronic
1117880673 14:60310343-60310365 CTGTGAGGTAGTGAGGTAGGAGG - Intergenic
1118840005 14:69502755-69502777 CTCTGAGGTCCTGAGGGAGCTGG - Intronic
1120644336 14:87055186-87055208 CTTTGAGTTTCTGTGGGAGCTGG - Intergenic
1121884159 14:97527579-97527601 CAGTTAGTTACTAAGGGAGCTGG - Intergenic
1122020685 14:98835405-98835427 GTGTGAGTGTGTGAGTGAGCCGG - Intergenic
1122811116 14:104288585-104288607 CTGTGAGTGAATGACGGAGGGGG - Intergenic
1123991883 15:25689507-25689529 CTGTGGGTTGCTGAGGGAGAGGG - Intronic
1124047512 15:26163914-26163936 CTGTGAGTTCATGTGGGAGCTGG - Intergenic
1124198791 15:27658406-27658428 CTGTGAAATAGTGAAGGAGAGGG - Intergenic
1124507289 15:30289336-30289358 CTGTGAGTTCATGCAGGAGCTGG + Intergenic
1124736266 15:32249323-32249345 CTGTGAGTTCATGCAGGAGCTGG - Intergenic
1125732402 15:41900574-41900596 CGGTGAGTCAGTGGTGGAGCAGG + Exonic
1127717323 15:61661856-61661878 CTGAGAGTCAGTGTGGGAGGAGG - Intergenic
1128329004 15:66743519-66743541 CAGCCAGTTAGTGAAGGAGCTGG + Intronic
1128878364 15:71220903-71220925 CTGTGATTTAGTGAGGGCAATGG + Intronic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1132136388 15:99344308-99344330 CAGTTAGTAAGTGAGGAAGCAGG + Intronic
1132250594 15:100332960-100332982 CAGTGAGACAGTGAGGGAGGAGG - Intronic
1132404316 15:101533223-101533245 CTGTGAGTTAGGGAAAGTGCTGG - Intergenic
1132406608 15:101545262-101545284 GTGTGAGACAGTGAGGAAGCCGG + Intergenic
1133317872 16:4895260-4895282 CTGTGACTTTGAGGGGGAGCAGG - Exonic
1134600281 16:15528554-15528576 GTGTGTGTAAGGGAGGGAGCTGG - Intronic
1135918585 16:26627571-26627593 ATGGCAGTTAGTGAGGGAGGGGG - Intergenic
1137420133 16:48326326-48326348 CTGTGGGTTAGGGATGGAGGAGG - Intronic
1137804766 16:51294512-51294534 CTGTGAGGAAGTAATGGAGCTGG - Intergenic
1138436058 16:57000723-57000745 CTGTGAGTCAGTGATGATGCAGG - Intronic
1138520966 16:57570634-57570656 CTGTGGGGCAGAGAGGGAGCTGG + Intronic
1138525846 16:57606885-57606907 CTGTGAGTTGGTGTTGGAGGTGG + Intergenic
1139489307 16:67278199-67278221 CTGGGAGTTAGGGATGGAGCAGG + Exonic
1141883308 16:86874272-86874294 CAGTGAATGAGTGAGGGAGCTGG - Intergenic
1142196668 16:88742279-88742301 CTGTGAGTCGCTGAGGGGGCGGG - Exonic
1142466481 17:140245-140267 GTGTGAGTCAGTGTGGGCGCTGG - Intergenic
1142625998 17:1192417-1192439 CAGTGAGTTATGGAGGGGGCAGG + Intronic
1145249738 17:21290502-21290524 CTGAGAGGTAGGTAGGGAGCTGG - Intronic
1147158429 17:38557233-38557255 TTATGACTTAGTGAGGAAGCTGG + Intronic
1147741889 17:42674720-42674742 CAGTGAGTTAGTGGTGGGGCGGG - Intronic
1148003952 17:44409685-44409707 CTGTTTTTTAATGAGGGAGCTGG - Intronic
1148438227 17:47698369-47698391 CTGTGTGTTAATGACAGAGCAGG + Intronic
1148670606 17:49407280-49407302 CTGAGAGTGAGGGAGGCAGCTGG + Intronic
1148865809 17:50627992-50628014 CTGTGGGTTGGTGGGGGAGGGGG + Intergenic
1150502913 17:65668315-65668337 CTGGGGATTAGTGAAGGAGCAGG - Intronic
1150854727 17:68741046-68741068 CAGTGAGTTGGATAGGGAGCTGG - Intergenic
1151077244 17:71287705-71287727 CTGAGAGTTGGTGGGGGAGGGGG + Intergenic
1151322196 17:73358905-73358927 ATGTGGGCCAGTGAGGGAGCCGG + Intronic
1152106554 17:78332712-78332734 CTGTCAGCTAGTCAGGGAGATGG - Intergenic
1153219107 18:2846957-2846979 CTGTGCGTCATTGAGGGACCGGG + Intergenic
1153344773 18:4013381-4013403 CAGTTAGTAAGTGAAGGAGCTGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153606244 18:6836329-6836351 GTGAGAGTGAGTGAGGGACCTGG + Intronic
1154355730 18:13622147-13622169 CTGTAAGTCAGGGTGGGAGCCGG - Intronic
1155026196 18:21943061-21943083 CTGCTAGTAAGTGATGGAGCCGG - Intergenic
1156744341 18:40370860-40370882 CTGTGTGTGAGTGAGTGAGAGGG - Intergenic
1157748021 18:50153799-50153821 GAGTGAGTGAGTGAGCGAGCGGG + Intronic
1158689152 18:59644722-59644744 CTGGGAGTTAGTGACGGTGTGGG - Intronic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158799527 18:60890016-60890038 CTTTGAAGTTGTGAGGGAGCTGG + Intergenic
1158901434 18:61965555-61965577 CTGTGAGTCAGTGAGAGGACTGG - Intergenic
1161770038 19:6226090-6226112 CGGTGAGTCTGTGAGGCAGCTGG + Intronic
1162043758 19:7985567-7985589 CTGAGGGTTTGCGAGGGAGCAGG + Intronic
1162057670 19:8074382-8074404 CTGTGAGGCAGTGGGAGAGCAGG + Intronic
1162061254 19:8096845-8096867 CTGGGAGGAGGTGAGGGAGCTGG - Intronic
1165649064 19:37469654-37469676 CTGTGAGTTGAGGCGGGAGCGGG + Intronic
1166148282 19:40851954-40851976 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166152425 19:40883739-40883761 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166171305 19:41029263-41029285 CAGGGAATAAGTGAGGGAGCTGG + Intergenic
1166177756 19:41086906-41086928 CAGGGAGTAAGTGAGGGAGCTGG - Intergenic
1166633723 19:44431017-44431039 CTGTGAGGCAGTGGTGGAGCTGG + Intronic
927097272 2:19757140-19757162 TTGTGAGGAAGTGATGGAGCAGG + Intergenic
927179056 2:20431043-20431065 CTGAGTGATAGTGAGAGAGCGGG - Intergenic
927640336 2:24841730-24841752 CTGTGGGTTGGAGAGGGAGCTGG - Intronic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
928376384 2:30778158-30778180 CTGTGAGTTACCCAGGGAGTGGG - Intronic
931762176 2:65427884-65427906 CTGTGAGTAACTGAAGGAGCTGG - Intronic
931991054 2:67790851-67790873 CTGTGAGTTAGGGAGGAAGCTGG - Intergenic
932761777 2:74442455-74442477 CGGTTAGTTAGTGACAGAGCTGG - Intergenic
932777158 2:74535275-74535297 CTGAGAGTGAGTGAAGGAGGGGG - Exonic
932943462 2:76197627-76197649 ATGTGAGTGAGTGTGGAAGCAGG + Intergenic
934680331 2:96278999-96279021 CTGTGGGTTGGAGAGGGAGAAGG + Intronic
935640757 2:105287811-105287833 CTGTGAGTAATGGAGGGAGGTGG + Intronic
935699832 2:105801868-105801890 CTGAGAGAAAGTGATGGAGCTGG + Intronic
936339080 2:111615579-111615601 TAGTGAGTTACTGAGGGATCTGG + Intergenic
936521938 2:113217036-113217058 GGGTGGGTTAGTGAGGGATCCGG - Exonic
937290167 2:120777324-120777346 GTGTGAGTGAGTGTGGGAGACGG + Intronic
938025419 2:127943729-127943751 GTGTGAGTCAGTGGGTGAGCAGG + Intronic
938136907 2:128766295-128766317 CTGGGAGGCAGTGAGTGAGCGGG - Intergenic
939242048 2:139573532-139573554 CTGTGAGTTAATGAGAGATCTGG + Intergenic
939521145 2:143232135-143232157 CAGTGAGTTAGTAAAGGAGAAGG + Intronic
939525726 2:143291401-143291423 CTGTGAGTGAGTGAGTGAGGAGG - Intronic
940488740 2:154329759-154329781 CTGTTAGTTCCTGAGAGAGCTGG + Intronic
941203666 2:162545387-162545409 CTTTGAAATAGGGAGGGAGCAGG - Intronic
943286246 2:186004869-186004891 ATGGCAGTTAGTGAGGGAGAGGG - Intergenic
944071505 2:195674977-195674999 CTGTGAGTGAGTCAGTGAGTGGG + Intronic
946407957 2:219502125-219502147 CCGGGAGTTGGTGTGGGAGCTGG + Intronic
947346516 2:229196190-229196212 CTGTAAAATAGTGAGGGAGAAGG + Intronic
948641612 2:239378976-239378998 CTGTGTGCCAGTGAGTGAGCGGG - Intronic
1169231630 20:3893199-3893221 TAGTGAGTTAGTGATGGAGTTGG + Intronic
1171975705 20:31593543-31593565 CTGTGAGGTGGGCAGGGAGCTGG + Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1172765648 20:37349342-37349364 CTGGGAGTGAGGTAGGGAGCAGG + Intronic
1172942465 20:38663950-38663972 CAGTGACTTAGTGAGGGACAGGG - Intergenic
1174105768 20:48161275-48161297 TTGGGAGTGAGTGAGGGGGCAGG - Intergenic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175417186 20:58809508-58809530 CAGCTAGTTAGTGAGGGGGCTGG + Intergenic
1176206313 20:63890336-63890358 CTGTGAGTCAGGGAAGGAGGAGG - Exonic
1176257824 20:64161596-64161618 CTTTGTGTGAGTGGGGGAGCAGG - Intronic
1176676108 21:9778920-9778942 CTCAGAGTCAGTGAGGGAGGAGG + Intergenic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1181100587 22:20536332-20536354 CTGTGTGTGAGTGTGGGAGGTGG + Intronic
1182779037 22:32852739-32852761 GTGTGTGTGTGTGAGGGAGCAGG + Intronic
1183717499 22:39542187-39542209 CTGTGAGTTTGGGTGGGGGCTGG - Intergenic
1183805243 22:40203847-40203869 CTGTTAGTCAGAGAGGGAGGAGG + Intronic
1184017195 22:41795201-41795223 CTGTGAGATCCTGAGAGAGCTGG - Intronic
949282407 3:2361810-2361832 CTGCGAATCTGTGAGGGAGCAGG + Intronic
950392334 3:12706442-12706464 CTATGAGGTAGTGAGGAATCAGG + Intergenic
953984509 3:47431032-47431054 CTGTGCCTTAGTGAGGGCTCTGG + Intronic
954094067 3:48309103-48309125 CTGTGAGTTTGTCATGGAGATGG + Intronic
954706149 3:52481642-52481664 CAGTGAGTGAGTGAGTGGGCAGG + Intronic
956258382 3:67309281-67309303 CAGTGAGTGAGGGAGGGCGCAGG - Intergenic
957800588 3:85074712-85074734 CAGACATTTAGTGAGGGAGCTGG - Intronic
958108384 3:89106844-89106866 ATGTGAGATGGTGAGGGAGGGGG + Intergenic
958110005 3:89130326-89130348 TTGGAAGTTAGAGAGGGAGCTGG - Intronic
960459652 3:117917856-117917878 AAGTGAGGAAGTGAGGGAGCAGG - Intergenic
960939956 3:122927115-122927137 CTAATAGTTAGTGAGGAAGCAGG + Intronic
962183911 3:133238108-133238130 ATGTGTGTGAGTGAGGGAGGAGG - Intronic
962789262 3:138796056-138796078 CTATGAGGTAGGGAGGGAGTGGG - Intronic
963097183 3:141556196-141556218 CTATGTGTTAGGTAGGGAGCTGG - Intronic
963345118 3:144087153-144087175 CTCTGAGTCAGTGAGGTAGAGGG - Intergenic
964643759 3:158936611-158936633 ATCTGAGTTAGTGAGGTGGCAGG + Intergenic
964673583 3:159253596-159253618 GTGTGTGTTTGTGAGGGAGAGGG - Intronic
965074354 3:163957562-163957584 TTGTGAGTAAGTGGGGAAGCAGG - Intergenic
966239989 3:177745230-177745252 CTGGGAGTCCGGGAGGGAGCCGG - Intergenic
967130465 3:186465700-186465722 CTGTAAGGGAGTGAGGGAGCCGG - Intergenic
969676744 4:8618593-8618615 CTGTGAGTGCCTGAGGGTGCCGG - Intronic
969683589 4:8656732-8656754 CTGTGAGTTCCTCATGGAGCGGG + Intergenic
969716633 4:8871204-8871226 CTGACAGTGAGTGAGGGCGCGGG - Exonic
972503536 4:39698706-39698728 CTGTGGGGTGGGGAGGGAGCAGG + Intronic
973127331 4:46603856-46603878 CTGTGAATGAATGAGTGAGCTGG + Intergenic
976281889 4:83334381-83334403 CTGAGAGTAAGGGAGGGAGAGGG + Intronic
976616054 4:87078417-87078439 CTGTGATTCAGTGAGGGTTCTGG + Intronic
976738581 4:88335385-88335407 CTATGAGTTTCTGAGAGAGCTGG - Intergenic
978293336 4:107173120-107173142 GTGTATGTCAGTGAGGGAGCTGG - Intronic
979111322 4:116761485-116761507 CTGTGATCTAGTGAGACAGCTGG + Intergenic
981130741 4:141155928-141155950 CTGGTGGTTAGTGAGGGAGGAGG + Intronic
981132947 4:141178630-141178652 CTTAGGGTTAGTGGGGGAGCGGG + Intronic
981528350 4:145730001-145730023 CTGTGGGGTAGTCAGGAAGCGGG + Intronic
981918465 4:150060594-150060616 GAGTGAGTTATTGAGGGAGTGGG - Intergenic
982739515 4:159043113-159043135 TAGGGAGTTAGTGAGGGAGAAGG - Intergenic
985148853 4:186924446-186924468 CTGAGAGAGAGAGAGGGAGCAGG + Intergenic
985399420 4:189579826-189579848 CTCAGAGTCAGTGAGGGAGGAGG - Intergenic
988555861 5:32235588-32235610 CTGTCAGTTAGTGTGTGGGCAGG - Intronic
992000368 5:72430321-72430343 CTGTTAGTTCCTGAGAGAGCTGG + Intergenic
993025828 5:82644967-82644989 CTTTCAGTTAGTGTCGGAGCTGG + Intergenic
993041729 5:82822314-82822336 CTGTGAGTTAGAAAGGGAAGAGG + Intergenic
993949823 5:94160750-94160772 CTCTGTGTTATTGAGGGAGAAGG - Intronic
994131581 5:96235281-96235303 CAATGAGTTAGTGTGAGAGCTGG - Intergenic
995782181 5:115789258-115789280 CTCTGAGTTAATGTGAGAGCTGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997511196 5:134455788-134455810 CTGGGAGATAGTGGGGGTGCTGG + Intergenic
998518718 5:142780855-142780877 CTGGGAGCTGGTGAGGGAGTCGG + Intronic
999089607 5:148924650-148924672 CTGTTAGTAAGTAATGGAGCTGG + Intronic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
1000888302 5:166773605-166773627 CTTTAAGTTAGTGAGGCAGTAGG - Intergenic
1001266739 5:170279275-170279297 CTGTAAGTTAGGGATGCAGCTGG - Intronic
1001436540 5:171703723-171703745 TTGTGAGGGAGTGAGAGAGCAGG - Intergenic
1001838922 5:174856645-174856667 CTGTGAGTTCATGTGAGAGCTGG - Intergenic
1002367426 5:178724131-178724153 CCGTGAGTTCGTGAGGGAGGAGG - Intronic
1002386023 5:178868039-178868061 CCGTGAGTTCGTGAGGGAGGAGG + Intronic
1003146086 6:3511795-3511817 CTGTTAGTTCCTGAGAGAGCTGG + Intergenic
1003667105 6:8121608-8121630 CTGTCAGGTACTGAGAGAGCTGG + Intergenic
1003944873 6:11065682-11065704 CTGTGAGGGAGTGAGGAAGCAGG - Intergenic
1004527817 6:16425797-16425819 TTGTGGTTGAGTGAGGGAGCAGG - Intronic
1006928484 6:37672875-37672897 CTGAGAGGCAGAGAGGGAGCAGG + Intronic
1010317319 6:74466447-74466469 CTGTGAGTCAGTGAGGTATAGGG + Intergenic
1010863893 6:80948425-80948447 CTGTATGTCAGTGATGGAGCTGG - Intergenic
1011233301 6:85187809-85187831 CCTTCAGTTTGTGAGGGAGCTGG + Intergenic
1011452230 6:87505720-87505742 GAGTTAGTTATTGAGGGAGCAGG - Intronic
1011467660 6:87675120-87675142 CTGTGAAATAGTGAAGGAGGAGG - Exonic
1012425698 6:99112179-99112201 CTGTAAGTTGGTGAGGGATGGGG - Intergenic
1013413663 6:109905239-109905261 CTGTGAGTTGTTGAGGGTGGGGG + Intergenic
1016047858 6:139498756-139498778 TTGTTAGTAAGTGATGGAGCTGG - Intergenic
1017969586 6:159299886-159299908 CTGGGAGTTTGTGAAGGACCTGG - Intergenic
1018421209 6:163642368-163642390 CTGGGGGTTAGGGAGGGAGCGGG + Intergenic
1018619369 6:165715190-165715212 CTGCGAGTGAATGAGGGCGCAGG - Intronic
1019676537 7:2316788-2316810 CAGTGAGTGAGTGAGTGAGTGGG - Intronic
1020245305 7:6424702-6424724 CTGGGAGTGGGTGCGGGAGCGGG - Intronic
1022738069 7:33094485-33094507 CTGTGAGGGATTGAGGGAGTTGG + Intergenic
1023973792 7:45011996-45012018 CTGTCAGTTATTGAGAGAGAGGG + Intronic
1026879516 7:73899910-73899932 CTGTGAGTCAGTGGGGCAGATGG - Intergenic
1027154007 7:75753589-75753611 ATGGTAGTTAGTGAGGGAGTGGG - Intergenic
1027629148 7:80580626-80580648 CTGTGAGTTAGTGGGGGACCAGG + Intronic
1030124205 7:106139180-106139202 CGGTGAGTTTGGAAGGGAGCAGG + Intergenic
1030454343 7:109754354-109754376 ATGTGAGGTGGTGAGGGAGGTGG + Intergenic
1031306945 7:120140300-120140322 TTATGAGTTAATAAGGGAGCTGG - Intergenic
1033258232 7:139820084-139820106 CTGGGAGTGAGAGTGGGAGCAGG - Intronic
1034174052 7:149086736-149086758 CTATTAGTTCCTGAGGGAGCTGG - Intronic
1035267839 7:157701776-157701798 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267855 7:157701874-157701896 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267871 7:157701972-157701994 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267903 7:157702168-157702190 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1036044030 8:5119878-5119900 CAGTGAGTCAGTGAGGGAACCGG - Intergenic
1036391328 8:8327013-8327035 CTATGATGTAGTGAGGGAGATGG - Intronic
1036753177 8:11455961-11455983 CTGTGAGTGAGTGTGGGGGGTGG + Intronic
1037438894 8:18893783-18893805 CTGTGAGCCAGTGAGAGAGAGGG - Intronic
1037931825 8:22885527-22885549 CTCCGAGTATGTGAGGGAGCTGG + Intronic
1038037294 8:23697081-23697103 CTGTGAGTTAGTGATGGAACTGG - Intergenic
1039114006 8:34072108-34072130 CGGGGAGTTAGTGGGGGGGCGGG - Intergenic
1039468856 8:37801506-37801528 CTGGGAGTGAGTGAGGGGGAAGG + Intronic
1043283595 8:78501475-78501497 CTCAGTGTTAGGGAGGGAGCTGG - Intergenic
1043444881 8:80309502-80309524 CAGTGAGTTAATGACAGAGCAGG - Intergenic
1045183481 8:99812164-99812186 ATCTGAGTGAGTGAGGGGGCAGG - Intronic
1046909921 8:119614482-119614504 TTGGGAGTTAGTGAGGAAACAGG + Intronic
1047654871 8:126966128-126966150 CTCTGAGTTTATGAGGGAGGAGG - Intergenic
1048568636 8:135630842-135630864 CTGTGGGTGAGTGAGTGAGTGGG + Intronic
1049101539 8:140582995-140583017 CTGCGTGTTAGTCAGGGACCAGG + Intronic
1049869098 8:144959390-144959412 TTGAGAGATAGTGAGGGAGGTGG + Intergenic
1051725836 9:20087913-20087935 CGGTGAGTGAGTGAGCGATCCGG + Intergenic
1052319327 9:27150698-27150720 CTGTGAGGCAGTGGGGGTGCAGG - Intronic
1052652866 9:31325937-31325959 GTGTGAGTGAGTGTGGGATCTGG + Intergenic
1055804530 9:80077625-80077647 CTGTGGGGGAGTGAGGCAGCAGG + Intergenic
1056545513 9:87609859-87609881 CTGAGGGTTAGTGATGAAGCGGG + Intronic
1057301820 9:93890796-93890818 CTGTGGGTTAGAGATGGAGGAGG + Intergenic
1057874724 9:98745233-98745255 CAGTGAATAAGTGAAGGAGCTGG + Intronic
1057995971 9:99821977-99821999 GTGTGTGCGAGTGAGGGAGCGGG - Exonic
1060085104 9:120691717-120691739 CAGGGAGTAAGTGATGGAGCTGG + Intronic
1060934160 9:127506133-127506155 CTGGGAGTGAGTGAGTGAGATGG - Exonic
1061724512 9:132574779-132574801 CTGTGAGTGACTGAGGGACTGGG + Intergenic
1061849273 9:133404982-133405004 CTGTCAGTTATAGGGGGAGCGGG - Intronic
1062413408 9:136435977-136435999 GTGTTACTTAGAGAGGGAGCGGG - Intronic
1187623476 X:21085262-21085284 CTGTGTATTAGTGGGTGAGCTGG - Intergenic
1189320095 X:40082650-40082672 CGGTGAGTGAGGGTGGGAGCCGG - Intronic
1189589559 X:42496827-42496849 CTGTCAGGTATGGAGGGAGCAGG - Intergenic
1189653148 X:43211515-43211537 GTGTGTGCTGGTGAGGGAGCAGG - Intergenic
1189974567 X:46448260-46448282 CTGAGACTAAGTGAGGAAGCTGG - Exonic
1190553254 X:51607278-51607300 ATATGAGGTATTGAGGGAGCAGG - Intergenic
1190567266 X:51743590-51743612 CTGTGTGGCAGTGAGGGAGCGGG - Exonic
1190624476 X:52323616-52323638 CAGTTAGTAAGTGATGGAGCTGG - Intergenic
1192588455 X:72339675-72339697 CTGAGAGATTGTCAGGGAGCAGG + Intronic
1192677040 X:73208898-73208920 ATGTGTGTGAGTGAGAGAGCCGG + Intergenic
1193173621 X:78366034-78366056 CAGTTAGTTAGTGATGTAGCTGG + Intergenic
1195069128 X:101262625-101262647 CTGTGACTTAGTGGTGGAGGAGG - Exonic
1198295520 X:135283060-135283082 CTGGGAGTTAGGGAGGAAGTAGG - Intronic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1200115111 X:153766495-153766517 CTGTGAGTCACAGAGGGGGCAGG - Intronic
1201475142 Y:14373609-14373631 CAGTGAGATCATGAGGGAGCTGG - Intergenic