ID: 928077933

View in Genome Browser
Species Human (GRCh38)
Location 2:28282170-28282192
Sequence TTATATCTACGGGGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928077933_928077938 4 Left 928077933 2:28282170-28282192 CCATTAAAACCCCGTAGATATAA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 928077938 2:28282197-28282219 AAGATGTTTTCCCAACCAAAAGG 0: 1
1: 0
2: 2
3: 16
4: 234
928077933_928077943 22 Left 928077933 2:28282170-28282192 CCATTAAAACCCCGTAGATATAA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 928077943 2:28282215-28282237 AAAGGAAGAAAACAAGGACATGG 0: 1
1: 1
2: 12
3: 223
4: 2171
928077933_928077941 16 Left 928077933 2:28282170-28282192 CCATTAAAACCCCGTAGATATAA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 928077941 2:28282209-28282231 CAACCAAAAGGAAGAAAACAAGG 0: 1
1: 0
2: 5
3: 81
4: 968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928077933 Original CRISPR TTATATCTACGGGGTTTTAA TGG (reversed) Intronic
900034948 1:399942-399964 TTATGTGTAAGGGTTTTTAAAGG + Intergenic
900056565 1:635694-635716 TTATGTGTAAGGGTTTTTAAAGG + Intergenic
905982210 1:42239509-42239531 TTAAATCTCCCTGGTTTTAAAGG + Intronic
911579273 1:99616771-99616793 TTATATCTTCTTGGATTTAAAGG + Intergenic
917071684 1:171158508-171158530 TTATTTCTACTGGGCTCTAAAGG - Intronic
922257475 1:223905499-223905521 TTATGTGTAAGGGTTTTTAAAGG + Intergenic
922989463 1:229894078-229894100 TTATAGGTACATGGTTTTAATGG + Intergenic
924338671 1:243008279-243008301 TTATGTGTAAGGGTTTTTAAAGG + Intergenic
1063543080 10:6954306-6954328 TTATATCTCCAGGTTTTTACTGG - Intergenic
1064595315 10:16938748-16938770 TCATATCTAAGGGGTTTTTTAGG - Intronic
1064873991 10:19972047-19972069 TTATAGCTACAGGCTTTGAAGGG + Intronic
1065455092 10:25898934-25898956 TTACATGTAAGGGTTTTTAAAGG + Intergenic
1080352671 11:31403363-31403385 TTATATATAAGGGTTTTTAAAGG + Intronic
1090361984 11:126179493-126179515 TCATATTTACAGGCTTTTAAGGG - Intergenic
1093167967 12:15827542-15827564 TTATAGCTCCAGTGTTTTAATGG - Intronic
1093254217 12:16845578-16845600 TTATATTTACAAGGTTTAAATGG + Intergenic
1098612443 12:72476977-72476999 TTATAGATATGGGGTTTTACAGG + Intronic
1106899231 13:34337432-34337454 TTGTGTCTACGGAGTTTCAATGG - Intergenic
1110283256 13:73719958-73719980 TTATATCTATGTGTTTTTAATGG - Intronic
1110645937 13:77884243-77884265 TTACATCTTAGGGGTTTTACAGG + Intergenic
1112117944 13:96377973-96377995 TTTTATTTACTGGGTTTTGATGG + Intronic
1112378247 13:98864054-98864076 TTAAATCCACTGGGTTTTAATGG - Intronic
1116349090 14:43836062-43836084 TTTTATCTACAGAGGTTTAAAGG + Intergenic
1117046835 14:51821304-51821326 TTATATATAGGAGATTTTAATGG + Intergenic
1118603666 14:67488021-67488043 TTGTATCCAGGGGGTTTTCAGGG - Intronic
1120338123 14:83185116-83185138 TCAGATCTACGGGATTTCAAAGG - Intergenic
1126201890 15:45995821-45995843 TTATGTGTATGGGTTTTTAAAGG + Intergenic
1126697090 15:51335607-51335629 TTATTTCCAGGTGGTTTTAAAGG + Intronic
1129088339 15:73121281-73121303 TTATATCTAAAGAGTTTTAAAGG - Intronic
1138746550 16:59369244-59369266 TTACTTATACGAGGTTTTAAAGG - Intergenic
1139084295 16:63565501-63565523 TTATATCTACTGTGTCTTTATGG - Intergenic
1149406683 17:56358992-56359014 TACTATCTATGGGGTCTTAATGG - Intronic
1155984866 18:32219184-32219206 TTAAAGCTACGAGTTTTTAAAGG + Intronic
1158988164 18:62840558-62840580 TTATATCAAAGTGGTTTTATGGG + Intronic
1163996181 19:21049327-21049349 TTATATCTACAGAACTTTAACGG + Intronic
926649184 2:15323144-15323166 TCATGTCTATGGGATTTTAAGGG - Intronic
927378075 2:22441928-22441950 TTAGATCTATGGGGATTTATGGG - Intergenic
928077933 2:28282170-28282192 TTATATCTACGGGGTTTTAATGG - Intronic
928187663 2:29127170-29127192 TAATATCTAAGGGGCTTTATTGG + Intronic
933468812 2:82693519-82693541 TAATATCTACTAGGTTTTACCGG - Intergenic
935249725 2:101251046-101251068 TGATATCTACTGAATTTTAAAGG - Intronic
935409679 2:102747914-102747936 TTATATCACTGAGGTTTTAAGGG - Intronic
937898438 2:126996757-126996779 TTACATGTAAGGGTTTTTAAAGG - Intergenic
940826494 2:158418062-158418084 TTACATTTATGGTGTTTTAATGG - Intronic
941173651 2:162170167-162170189 TTATATCTATGAGGTTTTTCTGG - Intergenic
941444706 2:165586280-165586302 TTTTATTTACTGGGTTTCAAGGG + Intronic
941460533 2:165766206-165766228 TTATTTCTACGTATTTTTAAAGG - Intronic
1171332982 20:24357646-24357668 TTACAGCTAAGGGTTTTTAAAGG + Intergenic
1178188295 21:30250450-30250472 TTTTTTCTATGGGTTTTTAATGG - Intergenic
949769836 3:7567805-7567827 TTATATGCAAGGGTTTTTAAGGG + Intronic
950319323 3:12035535-12035557 TTACATGTAAGGGTTTTTAAAGG + Intronic
950968127 3:17160806-17160828 TTCTCTCTAAGGGGTTTCAAAGG + Exonic
955678088 3:61470546-61470568 TTATATCTAGGTGGGTGTAATGG + Intergenic
955811980 3:62800637-62800659 TTATTTCTGCTGGGTTTTGAAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957533357 3:81468819-81468841 TTATATCTTTGGAGATTTAAAGG + Intergenic
957693299 3:83599471-83599493 TTATATCTCCTGGATTTTAGAGG - Intergenic
959749771 3:109819701-109819723 TTATGTCTACTGAATTTTAAAGG - Intergenic
962838476 3:139211559-139211581 TTATTTCTACAGTTTTTTAATGG + Intronic
966237208 3:177715160-177715182 TTACATCTCCGGGGTTTTCTTGG - Intergenic
973917683 4:55652834-55652856 TAATATCAAAGTGGTTTTAAAGG - Intergenic
976624208 4:87161505-87161527 TTATATGTAAGGAGTTATAAGGG - Exonic
977100455 4:92806089-92806111 TTATATGTACTGTGATTTAAGGG + Intronic
977289958 4:95154416-95154438 TTACTTCTACATGGTTTTAAGGG + Intronic
977901151 4:102423837-102423859 TTATGCCTAAGGGTTTTTAATGG - Intronic
978689039 4:111484268-111484290 TTATTTCTAGAAGGTTTTAAGGG - Intergenic
979204478 4:118021104-118021126 TTATATCTTCGTTCTTTTAAGGG + Intergenic
979238449 4:118426960-118426982 TTATGTGTAAGGGTTTTTAAAGG - Intergenic
981317746 4:143357424-143357446 TTTAATATACAGGGTTTTAAGGG + Intronic
981351216 4:143731854-143731876 TTATATCAAAGGGTTTTTAAAGG - Intergenic
982852182 4:160332346-160332368 ATATATCTATGGGGTTTTTTTGG + Intergenic
983603451 4:169557072-169557094 GTATATCAACAGAGTTTTAAAGG + Intronic
983616809 4:169715536-169715558 TGATATCTTCTGGTTTTTAAAGG + Intronic
997569666 5:134916720-134916742 TTATAAGTACGGAGTTTTCAAGG + Intronic
999334882 5:150706898-150706920 TTAAAGCTACGGGTTTTTAAAGG + Intergenic
999463383 5:151776544-151776566 TTATTACTTCGGGGTTCTAATGG + Intronic
1002738871 5:181418929-181418951 TTATGTGTAAGGGTTTTTAAAGG - Intergenic
1008246860 6:49186600-49186622 TTTTATTTATAGGGTTTTAATGG - Intergenic
1009919066 6:70034233-70034255 TTCTTTCTACAGGGTTTGAAAGG + Exonic
1014055540 6:117010712-117010734 TTATATCTCTGGTGTGTTAATGG + Intergenic
1014057376 6:117032181-117032203 TTAGATCTACTGGCTTATAAAGG - Intergenic
1015064382 6:129006273-129006295 TTATATTTTCAGTGTTTTAATGG + Intronic
1015184618 6:130400605-130400627 TTATTTCTGCTGGGTTTTGAGGG + Intronic
1016305464 6:142679216-142679238 TAATATCTCAGGGGTTCTAAAGG - Intergenic
1016685930 6:146882170-146882192 TTATAACTATGGAGTTCTAAGGG - Intergenic
1017330731 6:153195541-153195563 TTATCTCTTCAGAGTTTTAATGG - Intergenic
1019243979 6:170694481-170694503 TTATGTGTAAGGGTTTTTAAAGG - Intergenic
1022603507 7:31785054-31785076 CTATAGCCATGGGGTTTTAATGG + Intronic
1027329005 7:77071561-77071583 TTATAGGTAAGGGTTTTTAAAGG - Intergenic
1027812341 7:82919928-82919950 TTAAATCTGTGGGGTTCTAATGG - Intronic
1029786762 7:102799806-102799828 TTATAGGTAAGGGTTTTTAAAGG + Intronic
1033070060 7:138193807-138193829 TTTTATGTTCGAGGTTTTAAAGG + Intergenic
1035504147 8:113679-113701 TTATGTGTAAGGGTTTTTAAAGG + Intergenic
1037147017 8:15584818-15584840 TTATATGTACAGGGTTCTATTGG + Intronic
1037414493 8:18634966-18634988 TTATTATTACGGTGTTTTAAAGG + Intronic
1038702617 8:29863133-29863155 TTATAGGTAAGGGTTTTTAAAGG + Intergenic
1042353496 8:67801465-67801487 TAATATCTTCAGGGTTTTCACGG + Intergenic
1044379055 8:91511971-91511993 TTTTATCTACGTGGGTTAAAAGG + Intergenic
1044593729 8:93938935-93938957 TTATTTCTACATGGTTTAAATGG - Intergenic
1047852481 8:128873115-128873137 TTCTATATAGGTGGTTTTAAAGG - Intergenic
1048776214 8:137949430-137949452 ACATATTTACTGGGTTTTAAAGG - Intergenic
1052243825 9:26309062-26309084 TTTTATCTACGGATTTTGAAGGG + Intergenic
1055774905 9:79756913-79756935 ATATATTTATGGGGTTTTATGGG - Intergenic
1056661986 9:88550461-88550483 TTACATGTAAGGGTTTTTAAAGG + Intronic
1059106692 9:111518097-111518119 TTATATGTAAGAGTTTTTAAAGG + Intergenic
1203604168 Un_KI270748v1:43705-43727 TTATGTGTAAGGGTTTTTAAAGG - Intergenic
1186859645 X:13659414-13659436 TTATAGCTTCGGGGTTTCAGTGG + Intronic
1198867778 X:141143729-141143751 TTATATCAACTGGTTTTTAAAGG - Intergenic
1199584647 X:149401486-149401508 TTATATCCACAGGTTTTTGAGGG - Intergenic
1200271171 X:154685746-154685768 ATATATGTACGGGTTTTTTATGG - Intronic
1202386224 Y:24328752-24328774 TTATGTGTAAGGGTTTTTAAAGG - Intergenic
1202484562 Y:25341376-25341398 TTATGTGTAAGGGTTTTTAAAGG + Intergenic