ID: 928079859

View in Genome Browser
Species Human (GRCh38)
Location 2:28301289-28301311
Sequence GACACTTCCTGGCACTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928079855_928079859 16 Left 928079855 2:28301250-28301272 CCTGTAGAGCAAAATTCTAAACA 0: 1
1: 0
2: 0
3: 11
4: 188
Right 928079859 2:28301289-28301311 GACACTTCCTGGCACTGACCAGG 0: 1
1: 0
2: 0
3: 18
4: 227
928079853_928079859 20 Left 928079853 2:28301246-28301268 CCCTCCTGTAGAGCAAAATTCTA 0: 1
1: 0
2: 1
3: 15
4: 171
Right 928079859 2:28301289-28301311 GACACTTCCTGGCACTGACCAGG 0: 1
1: 0
2: 0
3: 18
4: 227
928079854_928079859 19 Left 928079854 2:28301247-28301269 CCTCCTGTAGAGCAAAATTCTAA 0: 1
1: 0
2: 0
3: 8
4: 153
Right 928079859 2:28301289-28301311 GACACTTCCTGGCACTGACCAGG 0: 1
1: 0
2: 0
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928079859 Original CRISPR GACACTTCCTGGCACTGACC AGG Intronic
900075371 1:811725-811747 GACACTTCCTGGGCCTGCCTGGG + Intergenic
900184545 1:1326949-1326971 GACACTGCTTGAAACTGACCAGG - Exonic
900761641 1:4476211-4476233 AATACTTCCTGGCACTAACAAGG - Intergenic
900865315 1:5264864-5264886 GAGACTTCCAGGCAGTAACCAGG - Intergenic
901082489 1:6591515-6591537 GACCGTTCCAGGCACTGAGCTGG - Exonic
901089118 1:6629694-6629716 GACGCTGCCTGGCACAGCCCAGG + Intronic
903050219 1:20595012-20595034 GACCCTTTCTGGCACTGTCGTGG - Intronic
905522633 1:38612247-38612269 GCCACCTCCTAGCACTGTCCAGG - Intergenic
907165149 1:52404103-52404125 AACAGTGCCTGGCACTGAACAGG + Intronic
907502081 1:54887935-54887957 AACACTGCCTGGCACAGAGCGGG - Intergenic
907707314 1:56844075-56844097 CACACTGCCTGGCACAGAGCAGG - Intergenic
908205414 1:61843070-61843092 ACCACTTCCTGGCACTCACTGGG - Intronic
908708052 1:66981960-66981982 GACACTTTCTTGCAGTGACTTGG + Intronic
910872340 1:91846385-91846407 CAAACTTCCTGGCACTCACAAGG + Intronic
914051247 1:144134664-144134686 GACTCTTCTTGGTACTGACTCGG + Intergenic
914127934 1:144830778-144830800 GACTCTTCTTGGTACTGACTCGG - Intergenic
915883069 1:159693614-159693636 GACAGTTCCTGTAACTGAACAGG - Intergenic
916366931 1:164039791-164039813 GACACTTCATGTCACATACCTGG + Intergenic
920376662 1:205512395-205512417 GACAGTGCCTGGCGCTGAGCAGG + Intronic
922271212 1:224036602-224036624 GACACTTCCTGGGTCTGCCTGGG + Intergenic
1066566361 10:36725668-36725690 GACACCTGCTGGGACAGACCTGG + Intergenic
1067249794 10:44576617-44576639 CTCACTTCCAGGCACTTACCAGG - Intergenic
1067466011 10:46499496-46499518 TAAACTTCCTGGCATTGAGCTGG - Intergenic
1067621177 10:47885110-47885132 TAAACTTCCTGGCATTGAGCTGG + Intergenic
1068810543 10:61251000-61251022 TACACTACCTAGCACAGACCAGG - Intergenic
1068998904 10:63241679-63241701 GACACTTCCTGTCACTTTCCAGG + Intronic
1070065558 10:73030193-73030215 GAGATTTCCTGACACTGAACAGG - Intronic
1070829878 10:79411726-79411748 GACTCTCCCTAGCACTGGCCTGG - Intronic
1073053120 10:100682169-100682191 GTAACTTGCTGTCACTGACCTGG + Intergenic
1073245998 10:102090596-102090618 GCCACCTCCTGGCAGTGAACTGG + Intergenic
1074059122 10:109948987-109949009 GATACCTGCTGGAACTGACCTGG - Intronic
1075998938 10:126900176-126900198 AACTCTCCCTGGCACTGTCCTGG + Intergenic
1076828073 10:132980418-132980440 GGCACTTGCGGGCACTCACCAGG - Intergenic
1076828107 10:132980582-132980604 GGCACTTGCGGGCACTCACCGGG - Intergenic
1076828143 10:132980757-132980779 GGCACTTGCAGGCACTCACCGGG - Intergenic
1077473446 11:2775574-2775596 CACAGTGCCAGGCACTGACCAGG - Intronic
1078134702 11:8642063-8642085 GCCGGTGCCTGGCACTGACCTGG - Intronic
1080558998 11:33444958-33444980 CACACTACCTGGCACAGAGCAGG + Intergenic
1082009889 11:47442661-47442683 AACACTCCATGGCACTGCCCAGG + Exonic
1082777867 11:57261517-57261539 CACACTTCCTGTCACAGAGCAGG - Intergenic
1082870683 11:57941913-57941935 ACCACTTCCTGGCAGTGTCCAGG + Intergenic
1082986425 11:59173735-59173757 CTCCCTTCCTGGCTCTGACCTGG - Intronic
1083854533 11:65386299-65386321 GACACTTCCTGGCACGTGCCAGG - Intergenic
1084011176 11:66349361-66349383 CACAGTTCCTGGCAGAGACCAGG - Intronic
1084727226 11:70949692-70949714 CACACTCGCTGGCACTGCCCTGG + Intronic
1086335369 11:85795466-85795488 TACACTGCCTGGCACAGACTAGG - Intronic
1086675286 11:89598689-89598711 AACACTTCATGTCATTGACCTGG + Intergenic
1089316212 11:117593052-117593074 CACAGTTCCTGGCACTTACGGGG + Intronic
1090374296 11:126277974-126277996 GCTTCATCCTGGCACTGACCAGG + Exonic
1094077904 12:26498029-26498051 TAGAATTCTTGGCACTGACCGGG - Intronic
1095777270 12:46023978-46024000 GACATTTCCTGGCACCAACCTGG - Intergenic
1096537776 12:52286417-52286439 GACACTGCCAGTCACTGGCCGGG + Exonic
1096621883 12:52870395-52870417 GACACCCTCTGGCACTGGCCAGG + Intergenic
1097848532 12:64389975-64389997 CACAGTGCCTGGCACTGACTAGG + Intronic
1098329956 12:69342740-69342762 GAGACTTCTTGCCACTGCCCTGG + Intergenic
1102568993 12:113815892-113815914 GACAGTGCCAGGCATTGACCAGG - Intergenic
1107413313 13:40177505-40177527 CACAGTTCCTGTCACTTACCAGG + Intergenic
1112389756 13:98972230-98972252 AACAGTTCCTGGCACAGAGCAGG + Intronic
1113471309 13:110548694-110548716 CACCCTTCCTGGCACTGAGCTGG - Intronic
1113915100 13:113865648-113865670 GACACTGCCTGGCACACAGCAGG - Intergenic
1119185524 14:72639230-72639252 TACAGTTCCTGGCAATGAACAGG - Intronic
1119667765 14:76497320-76497342 AACACTACCTGACATTGACCAGG + Intronic
1120062213 14:79997274-79997296 GTCAGTACCTGCCACTGACCTGG - Intergenic
1123113293 14:105882752-105882774 GTCACTGCCTGGCCCTGCCCTGG - Intergenic
1202931409 14_KI270725v1_random:38938-38960 GACTCTTCTTGGTACTGACTCGG - Intergenic
1123402622 15:20003187-20003209 GTCACTGCCTGGCCCTGCCCTGG - Intergenic
1123421022 15:20133173-20133195 GACTCTTCTTGGTACTGACTCGG + Intergenic
1123444738 15:20319525-20319547 GACTCTTCTTGGTACTGACTCGG - Intergenic
1123511961 15:21009841-21009863 GTCACTGCCTGGCCCTGCCCTGG - Intergenic
1123530246 15:21139702-21139724 GACTCTTCTTGGTACTGACTCGG + Intergenic
1124023959 15:25947604-25947626 GACACCTGCTGGGACAGACCTGG - Intergenic
1124322883 15:28728254-28728276 GACACCTGCTGGGACAGACCTGG + Intronic
1124574316 15:30894645-30894667 GACACCTGCTGGGACAGACCTGG - Intergenic
1124613039 15:31222182-31222204 GACAGTGCCTGGCAGTCACCTGG + Intergenic
1125889485 15:43254990-43255012 CACCCTGCCTGGCACTGAGCAGG + Intronic
1126572257 15:50164653-50164675 GACAAGTCCTGGTACTGTCCTGG - Intronic
1127650187 15:60999393-60999415 GTATCTTCCTGGCACAGACCTGG + Intronic
1136784541 16:32926791-32926813 GACACATCCTCTCGCTGACCAGG + Intergenic
1136885242 16:33927015-33927037 GACACATCCTCTCGCTGACCAGG - Intergenic
1137879411 16:52031110-52031132 GACCCTTGCTGGGACTGACTGGG - Intronic
1138014395 16:53415603-53415625 GACACCTGCTGGGACAGACCTGG + Intergenic
1138292432 16:55859357-55859379 GACACTTGCTGTGACTGTCCCGG + Intronic
1140677881 16:77351445-77351467 CACACTGCCTGACACAGACCAGG + Intronic
1141605701 16:85152166-85152188 GAGACATCCTGTCACTGACAGGG - Intergenic
1203087200 16_KI270728v1_random:1190797-1190819 GACACATCCTCTCGCTGACCAGG + Intergenic
1142609417 17:1100450-1100472 GGCCCTTTCTGGCAATGACCCGG + Intronic
1145957169 17:28862484-28862506 GACTCTGCCTAGCACTGCCCTGG + Intergenic
1146261983 17:31427871-31427893 GACACTGCCAGGCAATGACGTGG - Intronic
1147258674 17:39196641-39196663 GCCACTTCCTGGGAGTAACCAGG + Intronic
1150581298 17:66476368-66476390 AGCACTTCCTGCCACTGTCCTGG + Intronic
1150696945 17:67413707-67413729 CACACTTGCTGGCTATGACCTGG + Intronic
1152225642 17:79091388-79091410 GTCCTTTCCTGGCACTGGCCTGG - Intronic
1152465302 17:80462867-80462889 TACATTTCCTGAGACTGACCTGG - Intergenic
1152605910 17:81289940-81289962 GACACTTCCTAGCACTGAAAGGG + Intronic
1154415426 18:14173260-14173282 GCCTTGTCCTGGCACTGACCCGG - Intergenic
1156020251 18:32591890-32591912 TACATTTCCTTGCTCTGACCAGG - Intergenic
1156881068 18:42080098-42080120 GACACTTCCTGGCACATAGTAGG + Intronic
1156890181 18:42181680-42181702 ATGACTTCCTGACACTGACCTGG + Intergenic
1157696018 18:49724384-49724406 GACTCTTCCTGACACTGGCCGGG - Intergenic
1160057264 18:75495131-75495153 GACTTTTCCGGGTACTGACCTGG + Intergenic
1160218145 18:76952406-76952428 GACGCTTCCAGGCTCTGACCTGG + Intronic
1161000838 19:1909991-1910013 CACACAGCCTGGCACTGACACGG - Intronic
1161058576 19:2202662-2202684 GAGCCTTCATGGCACTGAACTGG + Intronic
1161997787 19:7724682-7724704 GACACTTCCTAGCAGGAACCAGG - Intergenic
1162078485 19:8205000-8205022 CACAGGCCCTGGCACTGACCAGG + Intronic
1164250792 19:23473171-23473193 TACAGTGCCTGGCACAGACCAGG - Intergenic
1165099493 19:33430436-33430458 GTCTCTTCCTGGCAGTGAACTGG - Intronic
1168224698 19:54986229-54986251 GACCCTTCAAGGCAATGACCAGG + Exonic
1168459502 19:56541556-56541578 AACTCTTCCTGTTACTGACCAGG + Intronic
1168472262 19:56649330-56649352 AACACTGCTTGGCACTGAGCAGG - Intronic
1202690653 1_KI270712v1_random:87304-87326 GACTCTTCTTGGTACTGACTCGG + Intergenic
927207087 2:20617542-20617564 GACAGGTCCTGGCACGGGCCAGG + Intronic
928079859 2:28301289-28301311 GACACTTCCTGGCACTGACCAGG + Intronic
928244066 2:29612057-29612079 GCCACTTCCAGGCCCTGAGCTGG - Intronic
933174496 2:79159863-79159885 GACTCTTCCTGGCAAAGACTGGG + Intergenic
933620834 2:84539339-84539361 CACACATCCTGGCACTGCTCTGG + Intronic
933955759 2:87368703-87368725 GACTCTTCTTGGTACTGACTCGG - Intergenic
934239912 2:90260736-90260758 GACTCTTCTTGGTACTGACTCGG - Intergenic
934273277 2:91556018-91556040 GACTCTTCTTGGTACTGACTCGG + Intergenic
935902960 2:107812138-107812160 CACACTTCCTGGCATGGTCCTGG - Intergenic
936092193 2:109508657-109508679 GACACTTCCTGGCTGTCTCCAGG - Intergenic
938746414 2:134282591-134282613 GACAGTGCCTGGCACAGAACAGG - Intronic
941677733 2:168361957-168361979 GACATTTCCTGGGACTTCCCTGG - Intergenic
943410533 2:187541398-187541420 GATGGTTCCTGGCACTGACTTGG + Intronic
945124362 2:206492015-206492037 GACAGTGCCTGGCACTTAGCAGG - Intronic
946249152 2:218402402-218402424 GCCTCTTCCTGGCCCTCACCTGG - Exonic
946536455 2:220635139-220635161 AACTCTTCCTGGCCCTGACTTGG + Intergenic
946728441 2:222685293-222685315 TACAGTTCCTGGCACAGAACTGG - Intronic
947190193 2:227496466-227496488 GACAGTTCCTGGCACACAGCAGG - Intronic
947714921 2:232334584-232334606 GGCACCTCCTGGCACTGCCCTGG - Intronic
947733996 2:232445535-232445557 GGCACCTCCTGGCACTGCCCTGG - Intergenic
948626142 2:239269423-239269445 CTGACTTCCTGGCACTGGCCAGG + Intronic
949082352 2:242113070-242113092 GACACTTCCTGGGCCTGCCTGGG - Intergenic
1171390934 20:24801328-24801350 GACCCTGCCTGGCTCTGAGCAGG - Intergenic
1173141740 20:40490785-40490807 GAGACTTTATGGCACTGACTGGG - Intergenic
1173669031 20:44784827-44784849 GACACTGGCTGGCACTCAGCAGG + Intronic
1175468968 20:59212144-59212166 GACACTTCCTGTCAATAACTTGG + Intronic
1175783852 20:61699943-61699965 GACACTTCCTGGGCTTGACATGG - Intronic
1176145442 20:63563373-63563395 GCCACTGCCTGGCACTGTGCCGG - Exonic
1176857896 21:13986004-13986026 GCCTTGTCCTGGCACTGACCCGG + Intergenic
1176866695 21:14058191-14058213 GCCTCATCCTGGCACTGACCCGG - Intergenic
1178601834 21:34001104-34001126 GACAGTGCCTGGCACAGAGCAGG - Intergenic
1179625151 21:42645063-42645085 CACACTTCCTTCCAGTGACCTGG - Intergenic
1180204502 21:46249727-46249749 GACAGTGCCTGGCACAGGCCAGG - Intronic
1180259670 21:46660596-46660618 GAGACTTCCTGAGCCTGACCTGG - Intronic
1181353235 22:22276660-22276682 GACTCTTCTTGGTACTGACTCGG + Intergenic
1181507023 22:23366082-23366104 GACACTTGCTGTGACTGGCCTGG + Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1184726566 22:46350762-46350784 CACACTGCCTGGCACTCACCTGG - Intronic
1185203574 22:49523477-49523499 GACCCTTCCTGGCTCTTCCCAGG + Intronic
1185273444 22:49939036-49939058 GGCACCTCCTGGCCCTGCCCAGG - Intergenic
950408020 3:12816660-12816682 GCGACTTCGTGCCACTGACCTGG + Exonic
953494279 3:43372779-43372801 GACAGTGCCTGGCACTGAGTTGG + Intronic
953744810 3:45566261-45566283 GACACTTGTTGGCCCTCACCAGG - Intronic
954759003 3:52860679-52860701 ACCACATGCTGGCACTGACCGGG + Intronic
957237104 3:77607901-77607923 GCCCCTTCCTGGCACGGAGCTGG + Exonic
959059252 3:101601192-101601214 AAGACTTCCTTGCACTAACCAGG - Intergenic
959268645 3:104175766-104175788 AACACTTCCTAGAACTGATCTGG - Intergenic
959503892 3:107136846-107136868 GTCACTTCCTTGCACTTCCCAGG - Intergenic
960874330 3:122282135-122282157 GAGACTGCCTGGCAGGGACCAGG + Exonic
960995752 3:123339119-123339141 GACACTTCCGGGTACTTCCCCGG - Intronic
961649345 3:128409760-128409782 GACACTTCCTGGGACTGCAGTGG + Intergenic
961673221 3:128549604-128549626 GGCACTTCCTGGCACATGCCAGG + Intergenic
966166032 3:177017388-177017410 GCCACTTTCTGGCACTAACAAGG - Intergenic
968218495 3:196915182-196915204 GGCACGTCCTGGCACTGTGCTGG + Intronic
968373029 4:12326-12348 GACTTTTCCTGGCACTGTCGTGG + Intergenic
969638232 4:8381814-8381836 GGCACTTCCTGGCTCAGCCCAGG + Intronic
969930850 4:10629352-10629374 GGCTATTCTTGGCACTGACCTGG + Intronic
970793214 4:19883958-19883980 AACACTGCCTGGCACAGAGCAGG + Intergenic
973839825 4:54850102-54850124 GCCTCTTCTTGGCACTGCCCAGG + Intergenic
977914449 4:102575918-102575940 GACATTTCCTGGCACTGATAAGG + Intronic
978967388 4:114757367-114757389 CACAGTTCCTGGCACTGAGTAGG - Intergenic
979711341 4:123783486-123783508 GAAAGTTCCTGGAAATGACCTGG + Intergenic
982261956 4:153501911-153501933 GATACTTCCAGGAAGTGACCTGG - Intronic
982291211 4:153784556-153784578 GACACTTTCTGGAAGAGACCTGG + Intronic
983506667 4:168560716-168560738 GACAGTACCTGGCACTTACTAGG - Intronic
983856747 4:172656226-172656248 GACACTGCATGGCAGTGTCCAGG - Intronic
983859125 4:172682779-172682801 AATACTTCCTGGAACTGACCAGG - Intronic
985884041 5:2662512-2662534 GACCCTGCCTGGTTCTGACCAGG + Intergenic
986052768 5:4105353-4105375 CTAACTTCCTGGCCCTGACCAGG - Intergenic
987970599 5:24939075-24939097 GACACTCCATGACACTGACCTGG + Intergenic
991666835 5:69007890-69007912 GACACTTCCTCCCACTCGCCAGG + Intergenic
999423637 5:151466938-151466960 GACCCTTCCTGGCAGTGACAAGG - Intronic
1000133329 5:158320775-158320797 GAAACTACCTGGCACTGGGCAGG + Intergenic
1000261173 5:159590065-159590087 GACACTTGCTTCCACTGTCCTGG - Intergenic
1000722082 5:164720570-164720592 GACAGTATCTGGCACTGAGCAGG - Intergenic
1001381330 5:171308537-171308559 GACACTCCCTGGCTCCGGCCAGG - Exonic
1001753572 5:174149578-174149600 TCCACTTCATGGCACTGACCAGG + Intronic
1002301472 5:178259673-178259695 GCCACTTCCCAACACTGACCCGG + Intronic
1002828426 6:795185-795207 GCCACATCCTGACACTGACAAGG - Intergenic
1005782044 6:29202237-29202259 GGCAGTTCCAGGCACTGACAGGG - Intergenic
1007609983 6:43143023-43143045 GGCACTGCCTGGCACAGAGCAGG - Intronic
1010305301 6:74314565-74314587 GACATGCCCTGGCACTGCCCAGG - Intergenic
1010535483 6:77023839-77023861 AACATTTCCTGCCACAGACCAGG - Intergenic
1011227082 6:85119516-85119538 GACACTTGCCGACACTCACCTGG + Intergenic
1011284067 6:85705498-85705520 GGCAGTTCCAGGCACTGACATGG + Intergenic
1012888927 6:104877149-104877171 GATACTTCATGGCACTTTCCTGG + Intergenic
1013652237 6:112207306-112207328 CACACTTTCTGGCATTGACTGGG - Intronic
1016608504 6:145962296-145962318 TTTACTTCCTAGCACTGACCTGG - Intronic
1017001381 6:149999902-149999924 GTCACCTACTGGCAATGACCTGG - Intergenic
1018059654 6:160080361-160080383 GAGAATTCCTGCCACTGACTGGG - Intronic
1018925418 6:168202437-168202459 GAAACTTCCTGTCTCTGTCCTGG + Intergenic
1019100678 6:169626592-169626614 TACACCTCCTGCCTCTGACCTGG + Intronic
1021836768 7:24684510-24684532 TACATTTCCTGGCCCAGACCTGG + Intronic
1023343520 7:39247851-39247873 GAAACTTCCAGGCTCTGACAGGG - Intronic
1023871720 7:44266807-44266829 GACACTGCCTGGCCCTGACAAGG - Intronic
1024315950 7:48016619-48016641 GACACTGCCTGACACTGGACAGG - Intronic
1026099022 7:67369312-67369334 GACACTGAGTGGCACTGCCCAGG - Intergenic
1026229853 7:68473202-68473224 GACACTGCCAGGCACTGAAAGGG + Intergenic
1027957824 7:84904093-84904115 GTCACTTCATGGTGCTGACCTGG - Intergenic
1030161538 7:106514153-106514175 GGCACTTCCTGGCTTTCACCTGG + Intergenic
1031121538 7:117727974-117727996 GCCACCTCCTGTCACTGACACGG - Intronic
1033521559 7:142166157-142166179 GAATCTTCCTGTCAGTGACCTGG + Intronic
1034213338 7:149383847-149383869 TACACTTCCCAGCACTGACCAGG + Intergenic
1034541986 7:151764263-151764285 GACACTTCAGGCCACTGCCCTGG + Intronic
1035540272 8:429796-429818 GACACTTCCTGGGCCTGCCTGGG - Intronic
1036782078 8:11656709-11656731 GACACTGCCTAGAACAGACCAGG + Intergenic
1037269743 8:17113538-17113560 TGCACTTCCTGCCACTGCCCTGG + Intronic
1038933805 8:32225367-32225389 GACACTTCATGGCTATGACAAGG - Intronic
1039282798 8:36005419-36005441 AACAGTTCCTGGCACTCACAAGG + Intergenic
1039839844 8:41285705-41285727 GGCACTCCCTGGCACTCACGGGG - Intronic
1040572277 8:48621741-48621763 TAAAGTTCCTGGCAATGACCAGG + Intergenic
1045612775 8:103866431-103866453 TACACTTCCTGTCACTGCACAGG + Intronic
1048582755 8:135743892-135743914 GACACATACTGGCACGGAGCTGG + Intergenic
1049171641 8:141165096-141165118 GAGCCTTCCTGGCACAGAACTGG - Intronic
1052742066 9:32402963-32402985 GACAGTGCCTGGCTCAGACCTGG + Intronic
1053691159 9:40588182-40588204 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1053692873 9:40604649-40604671 GACTCTTCTTGGTACTGACTCGG - Intergenic
1054271960 9:63035441-63035463 GACTCTTCTTGGTACTGACTCGG + Intergenic
1054273645 9:63049309-63049331 GCCCTCTCCTGGCACTGACCTGG - Intergenic
1054302419 9:63389153-63389175 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054304114 9:63403880-63403902 GACTCTTCTTGGTACTGACTCGG - Intergenic
1054401189 9:64715647-64715669 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054402860 9:64727893-64727915 GACTCTTCTTGGTACTGACTCGG - Intergenic
1054434800 9:65199973-65199995 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054436483 9:65213383-65213405 GACTCTTCTTGGTACTGACTCGG - Intergenic
1054493915 9:65808611-65808633 GACTCTTCTTGGTACTGACTCGG + Intergenic
1054495589 9:65821708-65821730 GCCCTCTCCTGGCACTGACCTGG - Intergenic
1055370462 9:75593059-75593081 GCCACTTCCTGGCTCTCACAAGG + Intergenic
1057178124 9:93014056-93014078 GAGCCCTCCTGGCACTGCCCTGG - Intronic
1058326380 9:103703609-103703631 AACCCTTCTTGGCACTGGCCTGG + Intergenic
1059214904 9:112552473-112552495 GACCCTCCCTGGCACAGGCCTGG - Intronic
1061589089 9:131587418-131587440 GAGATTGCCTGGCAGTGACCAGG + Intronic
1203623572 Un_KI270749v1:147317-147339 GACTCTTCTTGGTACTGACTCGG - Intergenic
1190100285 X:47517756-47517778 GTCACTTCCAGGCACTGCCTAGG + Intergenic
1191846201 X:65549912-65549934 GGCACTTCCTGGCGTTGCCCCGG + Intergenic