ID: 928081925

View in Genome Browser
Species Human (GRCh38)
Location 2:28319512-28319534
Sequence TTGTCCAGCTAGAACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928081925_928081933 28 Left 928081925 2:28319512-28319534 CCCTCAGGGTTCTAGCTGGACAA 0: 1
1: 0
2: 2
3: 6
4: 121
Right 928081933 2:28319563-28319585 CTTTGAGGACACAGCGGACTAGG 0: 1
1: 0
2: 1
3: 18
4: 133
928081925_928081929 4 Left 928081925 2:28319512-28319534 CCCTCAGGGTTCTAGCTGGACAA 0: 1
1: 0
2: 2
3: 6
4: 121
Right 928081929 2:28319539-28319561 AGGTTAACTCTGCTTGGCCTTGG 0: 1
1: 0
2: 2
3: 7
4: 129
928081925_928081932 22 Left 928081925 2:28319512-28319534 CCCTCAGGGTTCTAGCTGGACAA 0: 1
1: 0
2: 2
3: 6
4: 121
Right 928081932 2:28319557-28319579 CTTGGTCTTTGAGGACACAGCGG 0: 1
1: 2
2: 12
3: 30
4: 327
928081925_928081930 13 Left 928081925 2:28319512-28319534 CCCTCAGGGTTCTAGCTGGACAA 0: 1
1: 0
2: 2
3: 6
4: 121
Right 928081930 2:28319548-28319570 CTGCTTGGCCTTGGTCTTTGAGG 0: 1
1: 0
2: 3
3: 24
4: 262
928081925_928081928 -2 Left 928081925 2:28319512-28319534 CCCTCAGGGTTCTAGCTGGACAA 0: 1
1: 0
2: 2
3: 6
4: 121
Right 928081928 2:28319533-28319555 AACAACAGGTTAACTCTGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928081925 Original CRISPR TTGTCCAGCTAGAACCCTGA GGG (reversed) Intronic
900036454 1:413848-413870 ATTTCCTGCTAGGACCCTGACGG - Intergenic
900058083 1:649602-649624 ATTTCCTGCTAGGACCCTGACGG - Intergenic
900934225 1:5755282-5755304 GTGGCCTGCTAGGACCCTGATGG - Intergenic
901529218 1:9843116-9843138 GGTTCCAGATAGAACCCTGAGGG + Intergenic
902670493 1:17969960-17969982 GTGGCCAGCTAGAATCCAGATGG - Intergenic
908416972 1:63922856-63922878 TTTTCCAGCTCCAACTCTGAGGG + Intronic
912232415 1:107810659-107810681 TTGTTCAGCTCAAACACTGAGGG - Intronic
914905120 1:151737666-151737688 ATGTCCAGGCAGAACCCTGCTGG + Intergenic
916094672 1:161338789-161338811 TTCTCCAGGTATAACACTGATGG - Intronic
917620727 1:176793200-176793222 TTGTCTAGCTAGAGTCCTGGAGG + Intronic
918012764 1:180603181-180603203 CTGTCCTGATTGAACCCTGATGG + Intergenic
923278173 1:232416295-232416317 TTTTCCAGCTAGATCCCTTTTGG - Intronic
1067397391 10:45934682-45934704 TTTTCCTGCTTGAAACCTGATGG - Intergenic
1067412720 10:46079034-46079056 TTGTGCAGATAACACCCTGAGGG + Intergenic
1067521888 10:47013953-47013975 TTGGCCAGCAAGCACCCGGAGGG + Intergenic
1067865711 10:49903769-49903791 TTTTCCTGCTTGAAACCTGATGG - Intronic
1068155418 10:53191281-53191303 TGGTACAGCTAAAACCCTTATGG + Intergenic
1071989538 10:91088051-91088073 TTGTGCAGCTGGAACCTTCAGGG - Intergenic
1075587908 10:123670730-123670752 GTGCCCAGCTAGACGCCTGAGGG - Intronic
1079709375 11:23662416-23662438 TTGTCCAGCCAGGACACTGTTGG - Intergenic
1088000722 11:104876873-104876895 ATGTCCTGCGAGAAACCTGATGG - Intergenic
1088796552 11:113270506-113270528 TTCTCCATTTGGAACCCTGATGG + Intronic
1093130135 12:15381820-15381842 TTTTCCAGCTAAAACTTTGAAGG - Intronic
1097900531 12:64868693-64868715 TTTTCCAGCTGGAACCATGGAGG - Intronic
1098147268 12:67510560-67510582 TTGTCCTACTAGAAACCTCAGGG - Intergenic
1099231317 12:80028877-80028899 TTTTCCAGCTAGAACCATGGAGG + Intergenic
1103567095 12:121822347-121822369 TTCTCCAGCTAAACCCCTCAAGG - Intronic
1105301572 13:19140312-19140334 TTTTCCAGCTGGAAAACTGATGG + Intergenic
1109953354 13:69531956-69531978 TTGTCCTCCAAGAACTCTGATGG + Intergenic
1112308003 13:98292727-98292749 TTGTCCAGCCCAAAGCCTGAGGG + Intronic
1113385736 13:109846307-109846329 ATGTCCAGATTTAACCCTGATGG + Intergenic
1115503875 14:34075507-34075529 TTTTCCAGCTAGAAACCCCAGGG + Intronic
1119137103 14:72231144-72231166 CAGTCCAGCCACAACCCTGAGGG - Intronic
1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG + Intergenic
1123753855 15:23381126-23381148 TTTTCAAGCTGAAACCCTGAGGG + Intergenic
1124193039 15:27597197-27597219 TTGTTCAGGTAAGACCCTGATGG - Intergenic
1126249132 15:46545852-46545874 TTCTCCTGCCAGAACCATGAAGG + Intergenic
1127372274 15:58352584-58352606 TTGTCCCTCTACAACCCTTAGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129361936 15:75029746-75029768 CTGCCCAGCTAGAGCCGTGAGGG + Intronic
1130552932 15:84903524-84903546 TTGTCCAGGATGCACCCTGAAGG - Intronic
1131457395 15:92593125-92593147 TTCTCCAGCTATACCCCTGCAGG + Intergenic
1134053765 16:11156408-11156430 TTGGCCAGCCAGAACCTTGGGGG + Intronic
1138222826 16:55267422-55267444 TTGTCCCCCTAGCACCCTGTTGG + Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1145099688 17:20064248-20064270 TTGCACATCCAGAACCCTGATGG + Intronic
1147965465 17:44192243-44192265 TGGTCCAGCAGGGACCCTGAGGG - Exonic
1158524498 18:58200357-58200379 TTGTCCAGCTAGCACATTGCTGG - Intronic
1158546785 18:58404173-58404195 TCTCCCAGCTAGAAACCTGAGGG + Intergenic
1159020086 18:63136132-63136154 ATGTCCAGACAGAAGCCTGATGG - Intronic
1160146234 18:76367384-76367406 TTCTCAAGCTACAACTCTGACGG + Intronic
1162796317 19:13089377-13089399 TTGTCCAGATGGAGCCCTGCTGG - Intronic
1164907755 19:31981487-31981509 TTGTCCAGCTCGAGGCCTGTAGG - Intergenic
926854141 2:17233954-17233976 ATATACAGCTACAACCCTGATGG - Intergenic
926995659 2:18732756-18732778 TCTTCCAGTTAGAACCCTCAAGG + Intergenic
928081925 2:28319512-28319534 TTGTCCAGCTAGAACCCTGAGGG - Intronic
929092333 2:38231552-38231574 TTTTCCAGCTGGAACCATGGAGG + Intergenic
929484558 2:42342212-42342234 TGGTACAGCTGGAACCCTGAAGG + Intronic
937225868 2:120368414-120368436 ATGGCCACCTAGAAGCCTGAGGG + Intergenic
946032025 2:216712952-216712974 TTGTCTAGCTTGAAAACTGATGG - Intergenic
947544843 2:231003322-231003344 CTGTCCTGCAAGACCCCTGAGGG + Intronic
1169421701 20:5465681-5465703 TTCACCAGCTAGAAACCTCATGG - Intergenic
1170539035 20:17369791-17369813 TTGTCCAACAAGAACCCAAATGG - Intronic
1170945004 20:20883477-20883499 TTGTACAGAAAGAGCCCTGAAGG + Intergenic
1172092141 20:32440819-32440841 TTGGCCATCAAGACCCCTGATGG - Intergenic
1173400435 20:42721516-42721538 TTGTCCAACCAGAAGCCTGAGGG - Intronic
1176261597 20:64184752-64184774 TCCTCAAGCCAGAACCCTGAGGG - Intronic
1176837083 21:13803202-13803224 TTGATCAGCTCGAACCCAGAAGG + Intergenic
1177529430 21:22340738-22340760 GTGTCCAGGTAGAAGCCTGAAGG - Intergenic
1179180184 21:39038011-39038033 TTGCCCACCTAGAACCAGGAGGG - Intergenic
1183440638 22:37821228-37821250 TAGTCCAGCTGGAGCCCAGATGG - Intergenic
1184304224 22:43584516-43584538 TTCCCCTGCCAGAACCCTGAGGG - Intronic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
950399365 3:12758832-12758854 GGGTCCAGCTAGATCTCTGAAGG - Intronic
950618528 3:14182561-14182583 TTGTTCATAGAGAACCCTGAAGG + Intronic
952484204 3:33793194-33793216 TTTTCCAACGAGAACCCTGGTGG + Intergenic
954648930 3:52148311-52148333 TTGTCCTGGGAGACCCCTGATGG - Intronic
958904354 3:99925621-99925643 CTGTCCAGCTGGTACCCTTAGGG + Intronic
960769322 3:121174789-121174811 TTCTCCAGCAAGAACCCTGAAGG - Intronic
961412847 3:126735337-126735359 TTATCCATCTAGAGACCTGAGGG - Intronic
962876698 3:139540694-139540716 TTATCCAGCTTGTCCCCTGATGG + Intergenic
962882348 3:139590059-139590081 ATGTCCAGCTAGGACCTGGAGGG + Intronic
967949608 3:194830629-194830651 GTGTCCTGCTGGAACGCTGATGG - Intergenic
971993137 4:33927860-33927882 TTGTCCAGCTGGCAGCCTGTGGG - Intergenic
971995180 4:33955605-33955627 ATGTGCAGCTTGAACCCTCATGG - Intergenic
974232004 4:59128438-59128460 TTGTTCAGGTAGAACATTGAGGG - Intergenic
976009107 4:80465923-80465945 TTGTCCAGCTGCAATCCTCAGGG - Intronic
977187852 4:93962593-93962615 TTCTCCAGCTTGAACCCAGGAGG + Intergenic
981881204 4:149614820-149614842 TTGTCCAGCTCGCAGCCTGTGGG - Intergenic
982957458 4:161790396-161790418 TTGTCAAGCTAGAAACCCTAGGG - Intronic
984697142 4:182790571-182790593 GCGTCCAGCTAGGACCCTCATGG + Intronic
992074333 5:73176944-73176966 GTGTCCAGCCAGAACCCACAGGG + Intergenic
995286631 5:110396275-110396297 ATGTCCAGGTAGGAACCTGATGG - Intronic
996320625 5:122211338-122211360 CTGATCAGATAGAACCCTGAAGG + Intergenic
996334730 5:122370686-122370708 TAGTCTAGATATAACCCTGAAGG + Intronic
999089621 5:148924875-148924897 TTGTTCAGCCAGAACACAGACGG + Intronic
999302796 5:150501518-150501540 TGGGCCAGCTAAAACCCTGAGGG - Intronic
1002737367 5:181405016-181405038 ATTTCCTGCTAGGACCCTGACGG + Intergenic
1004083354 6:12418673-12418695 TTGTTCAGGTTGAACCATGATGG + Intergenic
1004816059 6:19312807-19312829 TTTTCCAGCTAAAACCCTGAAGG - Intergenic
1008374819 6:50779490-50779512 TTGCCCAGGGAGAACGCTGATGG - Intergenic
1009658017 6:66570484-66570506 TTGTCCAACTCGAGGCCTGAAGG - Intergenic
1013796974 6:113899110-113899132 TTGTACAGCTAGAATACTGAGGG - Intergenic
1015258459 6:131207262-131207284 TTGTCCTCCTAGAAGCCAGATGG + Intronic
1017867469 6:158456303-158456325 TTGTCCAGCTTGCAGCCTGTGGG + Intronic
1018945023 6:168341635-168341657 GTGTCCAGCTAGAACATGGAAGG + Intergenic
1019242462 6:170680572-170680594 ATTTCCTGCTAGGACCCTGACGG + Intergenic
1019751821 7:2735362-2735384 TGACCCAGCTAGAACCCTGCAGG - Intronic
1021999880 7:26216431-26216453 GAGTCCAGCTAGGAGCCTGAGGG - Intergenic
1023360215 7:39407841-39407863 TTGTCCCGTCAGAACCCCGAGGG + Intronic
1024520424 7:50301182-50301204 TTGTCCAGGTAGAGCCTGGATGG - Intergenic
1029811475 7:103053481-103053503 GTGTCCAGCTAGAAGCCCGTAGG - Intronic
1033215380 7:139489801-139489823 ATGTCATGCTTGAACCCTGATGG - Intergenic
1035505655 8:127582-127604 ATTTCCTGCTAGGACCCTGACGG - Intergenic
1037390755 8:18389079-18389101 ATGTCCAGCAAGAACCGTCATGG - Intergenic
1038007308 8:23443151-23443173 TTTTCCAGCTAGGGCCATGATGG - Intronic
1042538311 8:69881717-69881739 GTTTCCTTCTAGAACCCTGATGG - Intergenic
1046174192 8:110553457-110553479 TTTTTCACCTAGAGCCCTGATGG + Intergenic
1047872841 8:129104090-129104112 TTGACCAGCCCAAACCCTGAGGG + Intergenic
1049444030 8:142621874-142621896 TTGTGCTGCAGGAACCCTGAGGG + Intergenic
1056543811 9:87596423-87596445 CTGCCCAGCCAGAACACTGAAGG + Intronic
1059256980 9:112939742-112939764 CTGTTCAGCTGGAACCCTGGGGG + Intergenic
1061650085 9:132040636-132040658 TTGACCAGATTGAAGCCTGATGG - Intronic
1062060058 9:134490438-134490460 TTGTCCCCCTGGAACCCGGAGGG - Intergenic
1203602653 Un_KI270748v1:29796-29818 ATTTCCTGCTAGGACCCTGACGG + Intergenic
1185937685 X:4277295-4277317 TTCTCCAGCTAGAACACTAGAGG + Intergenic
1186598500 X:11010145-11010167 TTTTCAAGCAAGAACCCTGGTGG - Intergenic
1192031912 X:67523036-67523058 TTGGCCAGCTAGAAGGCTTATGG + Intergenic
1194412460 X:93573801-93573823 TTTTCCAGCTGGAACCATGGAGG + Intergenic
1196391933 X:115216791-115216813 TTTTCCAGCTGGAACCATGGAGG + Intronic