ID: 928081984

View in Genome Browser
Species Human (GRCh38)
Location 2:28319896-28319918
Sequence GGGAAGTGACCTCACTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928081979_928081984 1 Left 928081979 2:28319872-28319894 CCAGAATAGACAGGCTCACGGTG 0: 1
1: 0
2: 0
3: 6
4: 43
Right 928081984 2:28319896-28319918 GGGAAGTGACCTCACTCCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928081984 Original CRISPR GGGAAGTGACCTCACTCCCG AGG Intronic
904702344 1:32365417-32365439 TGGAAGTGACCTCACTCTCTCGG + Intronic
905340071 1:37272208-37272230 GGCAAGTCACCCCACTCCCCAGG + Intergenic
906306676 1:44724276-44724298 GGCAAGAGACCGCCCTCCCGTGG - Intronic
912167744 1:107060275-107060297 TGGAGGTGTCCTCACTCCAGAGG - Intergenic
919808577 1:201395388-201395410 GGGAAGTGAGCACACTAACGTGG + Intronic
920044955 1:203127170-203127192 GGGAAGTGACCTAGCTTCCCAGG - Exonic
920049892 1:203157539-203157561 GGGCAGTGGCCTCACTCCCATGG + Intronic
920195453 1:204223410-204223432 AGGAAGGGGCCCCACTCCCGAGG + Intronic
920261918 1:204694054-204694076 GGGAAGAGACCTCTCTCCAGTGG - Intergenic
1063421010 10:5912503-5912525 GGGAAGGGACCCCCCTCCCCCGG - Intronic
1066656540 10:37703247-37703269 GGGAAGTGACAGCCCTCCCTGGG - Intergenic
1067041050 10:42953455-42953477 GGGAAGTGACAGCCCTCCCTGGG - Intergenic
1072791165 10:98318853-98318875 GGGAACTGCCCTCAGTCCTGGGG + Intergenic
1079276230 11:19040213-19040235 GCCAAGTGGCCTCACTCCCACGG + Intergenic
1081399124 11:42622295-42622317 GGGTAGTGACCTCTCTCCCTAGG + Intergenic
1081584211 11:44373032-44373054 GGGAACTGGCCTCACTCACGTGG + Intergenic
1081856804 11:46309050-46309072 GGGTTATGACCTCACTCGCGTGG - Intronic
1081868502 11:46372547-46372569 GGGAACTTGCCTCACTCCTGGGG + Intronic
1083312259 11:61790113-61790135 GGCAAGTGACCTAACTCCTCTGG - Intronic
1091406885 12:214589-214611 GGGAGGTGACCTCACTGACGAGG + Intergenic
1096217971 12:49808959-49808981 GGGAGGTGACCTCAGTGCAGGGG + Intronic
1096386856 12:51199852-51199874 GTGAAGTGAAGTCACCCCCGGGG - Exonic
1097179376 12:57162591-57162613 GGGAAGTGCCTTCACTCCCAGGG - Intronic
1097324145 12:58256804-58256826 GGGAATTAACCTCACTCCACTGG - Intergenic
1099957621 12:89366804-89366826 GGGAACTGTCCTCACTCCTTAGG + Intergenic
1101249379 12:102917138-102917160 AGCCAGAGACCTCACTCCCGGGG - Exonic
1101259097 12:103011086-103011108 GGGAGGTGATATCACTCCCATGG + Intergenic
1103567963 12:121826592-121826614 GGTAAGTGACCTGTCTCCTGGGG + Intronic
1103791866 12:123477834-123477856 GGGAAGTGGCCTCAAACACGGGG + Intronic
1104529302 12:129553881-129553903 GGGAAGTGACATTTCTCCCATGG - Intronic
1106402366 13:29442745-29442767 GGGAAGTGTCCTCAAGCCTGTGG - Intronic
1112434515 13:99382508-99382530 GGGCAGTGGCCTCACTGCCCTGG + Intronic
1113856432 13:113448862-113448884 GGGAAGTGGCTTCCCTCCCAGGG - Intronic
1119512492 14:75222339-75222361 GGGAAGTACACTCACTCCCCAGG + Intergenic
1121457701 14:94049240-94049262 GGCAAGTGGCTTCACTCCCACGG + Exonic
1128087764 15:64897639-64897661 GGGAAGTGGATTCACTCCCTGGG - Intronic
1131072296 15:89473424-89473446 GAGAAGCCACCTCACTCCCAAGG + Intronic
1136643906 16:31592035-31592057 AAGAAGTGACCTCACTTCCTTGG - Intergenic
1136661703 16:31768739-31768761 AAGAAGTGACCTCACTTCCTTGG + Intronic
1145014373 17:19387092-19387114 GGGAACTGAGCCCACTCCAGAGG - Exonic
1145940926 17:28743217-28743239 GGGAGGTGGCAGCACTCCCGGGG - Exonic
1148615456 17:48997231-48997253 GGGAACTCAACTCACCCCCGGGG - Intergenic
1152260860 17:79266296-79266318 GGGAAGTGTCCTCATCCTCGTGG + Intronic
1157477368 18:48031903-48031925 GGGAAGTTGCATCACTCCAGGGG - Intronic
1160703989 19:520860-520882 GGCAGGTGACTTCACTCCCTTGG + Intergenic
1161067825 19:2247275-2247297 GCCAAGTGACCTCACTTCCTGGG + Intronic
1161070301 19:2256492-2256514 CGGCTGTGACCTCACTCCAGCGG - Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1166111966 19:40627950-40627972 GGGAAAGGACCTCACTACAGGGG + Intronic
1166296190 19:41890953-41890975 GGGAAATGAACTCACTCCAATGG - Intronic
1166607017 19:44152368-44152390 TGGATGTGACCTCACTCTAGGGG + Intronic
1166676292 19:44742995-44743017 GAGAAGTGAACTCACTGCCCGGG - Intergenic
1168306757 19:55440194-55440216 GGCAAGTGACCTCACCTCTGTGG - Intronic
1168340656 19:55621456-55621478 GGGAAGTGACATCCAGCCCGTGG + Exonic
927138096 2:20111940-20111962 AGGAAGTGAACTCACATCCGAGG - Intergenic
927504274 2:23603106-23603128 GGGAAGTGACCCCCCACCCCAGG + Intronic
928081984 2:28319896-28319918 GGGAAGTGACCTCACTCCCGAGG + Intronic
929077405 2:38089509-38089531 GGGAAGTAACCACACCCCCCTGG - Intronic
933902774 2:86861592-86861614 GGGAGGTGGCCTCAGTCCAGGGG + Intronic
934714860 2:96537529-96537551 GGGAAGCGACCCCTCTCCTGTGG - Intronic
935645438 2:105329994-105330016 GAGAAGAGACCTCAGCCCCGCGG - Exonic
936042885 2:109163161-109163183 GAGAACTGAGCTCACCCCCGAGG + Intronic
936044986 2:109180431-109180453 GGGAAGTCACCTGACCCCTGAGG - Intronic
941328223 2:164143734-164143756 GCGAAGTGGCCTCAGTCGCGGGG + Intergenic
946102476 2:217337949-217337971 GGGAAGTGACCTCATACCCTGGG - Intronic
947429337 2:230011913-230011935 GTGAAGTGACCTTTCTCCCCAGG - Exonic
1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG + Intergenic
1179493778 21:41758822-41758844 GGGAAGTGACCTTAGACCAGAGG - Intronic
1179502734 21:41820220-41820242 GGAAAGTGCCCTCGCTGCCGTGG - Intronic
1179703760 21:43170087-43170109 GGGCAGTGACCTCATTCCACAGG + Intronic
1181313507 22:21957959-21957981 GGGATGGGGTCTCACTCCCGGGG + Intronic
1181346614 22:22224031-22224053 GGGATGGGGTCTCACTCCCGGGG + Intergenic
1184889000 22:47368167-47368189 GGGCAGTGACATCACTGCCAAGG - Intergenic
949446791 3:4143705-4143727 GGAAAGTTACCTAACTCCCTGGG - Intronic
952321646 3:32283476-32283498 GGGAAGGAAGCTAACTCCCGGGG - Intronic
954117417 3:48474868-48474890 GGGAAGTGACCTGAGGCCTGAGG - Intronic
961440731 3:126951679-126951701 GGGAACTGACCTCACACCTCTGG - Intronic
968873978 4:3255593-3255615 AGTAAGTGACCTGACTCCCTGGG + Intronic
969617472 4:8262085-8262107 GGTCAGTGACGTCACCCCCGAGG - Intergenic
969962810 4:10962740-10962762 GGCCAGTGCCCTCACTCCTGCGG - Intergenic
972626552 4:40805043-40805065 GAGAAGTGAGCTCGCTGCCGTGG - Intronic
974444582 4:61963050-61963072 AGGAAGTGACATCACTTCCTAGG + Intronic
975070290 4:70127874-70127896 GGGAACTGTTTTCACTCCCGTGG + Intergenic
985773415 5:1826932-1826954 TGGAAGTGACTGCTCTCCCGCGG + Intergenic
987500113 5:18698353-18698375 GGGAAGGGCCCCCTCTCCCGTGG - Intergenic
988442678 5:31250281-31250303 GGGAAGTGACCCCACTGCTAGGG - Intronic
989668525 5:43886740-43886762 GGGAAGTAAACTCACTCCAGAGG + Intergenic
992984812 5:82217243-82217265 GGTAAGTTACCTAACTCCCTTGG + Intronic
1000539772 5:162525714-162525736 GTGAAGTGACATCACTCCTGGGG + Intergenic
1003730286 6:8814059-8814081 GGGAAGTGAGCACTCTCACGTGG - Intergenic
1019529133 7:1494960-1494982 GGGAAGGGACCCCGCTCCCACGG + Intronic
1019702498 7:2480705-2480727 GGGAAGTGCCCTCCGTCCTGAGG - Intergenic
1021761705 7:23908661-23908683 GGGAACTAATCTCACTCACGAGG - Intergenic
1024223065 7:47303304-47303326 GGGAAGTGGCCTTCCGCCCGAGG - Exonic
1032850483 7:135790820-135790842 GGGAAGTCACTTCACTTCCCTGG + Intergenic
1034969304 7:155409194-155409216 GGGAAGGGAACTGACTGCCGAGG + Intergenic
1040392393 8:46961337-46961359 AGGAAATGACCTCACTTCCTTGG + Intergenic
1040595555 8:48834532-48834554 GGGACGAGGCCTCACTCCCAGGG + Intergenic
1040824806 8:51609399-51609421 AGGAAGTGTCCTCTATCCCGGGG + Intronic
1041945226 8:63433508-63433530 GGCAAGTGACCTGATTCCCCAGG + Intergenic
1047206233 8:122804755-122804777 GGGAGGTCACCTAACTCCCTTGG + Intronic
1047297931 8:123587781-123587803 GGGCAGTGAACTCCCTTCCGCGG + Intergenic
1048248255 8:132833193-132833215 AGGAAGTGAGCTCACTCACAAGG - Intronic
1049170908 8:141160047-141160069 GGGGAGTGCCCTCACTGCAGTGG + Intronic
1049316966 8:141974488-141974510 GGGAAGTAAACTCACGCCCGGGG - Intergenic
1049442465 8:142615572-142615594 CAGAAGGGACCTCCCTCCCGAGG - Intergenic
1053399022 9:37801117-37801139 GGGAGGTGACGGCTCTCCCGGGG - Exonic
1057706203 9:97396736-97396758 GAGAAGTGACCTAACTTCCTTGG - Intergenic
1060553609 9:124497274-124497296 GGCAAGTGACTTCACTCCTCCGG - Intronic
1192803855 X:74493145-74493167 GGGAAGTGCCCTCACTGAAGAGG + Intronic
1193197667 X:78653727-78653749 GGCAAGTAACCTCACTTCAGTGG + Intergenic
1198534539 X:137573895-137573917 GGGAAGGGACCTCATTTCCTAGG + Intronic
1199046876 X:143184801-143184823 TGGAAGTGAACTGACTCCAGTGG + Intergenic
1201149324 Y:11087170-11087192 AAGAAGTGACCTCACTTCCTTGG - Intergenic