ID: 928083382

View in Genome Browser
Species Human (GRCh38)
Location 2:28329295-28329317
Sequence AGTTTTATACAAATGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928083382 Original CRISPR AGTTTTATACAAATGGGGTA GGG (reversed) Intronic
900671900 1:3859498-3859520 AGTGTTGTGCAAATGGGGTCAGG + Intronic
907411116 1:54283989-54284011 CTTTTTTTAAAAATGGGGTAAGG + Intronic
907510431 1:54954100-54954122 AGTTTAATAAAAATCAGGTATGG + Intergenic
908011287 1:59779905-59779927 GATTTAATACAAATGGGGTTAGG + Intergenic
909219256 1:72933848-72933870 AATTTTAAACAAATGGTGTTTGG + Intergenic
910434580 1:87192188-87192210 AGTTTTATAAAAATGGGGGTGGG - Intergenic
910456504 1:87403242-87403264 AGCTTTATACAAATGTAGAAAGG + Intergenic
910695567 1:90011150-90011172 TGTTATATAAAAAGGGGGTATGG - Intronic
910980550 1:92956257-92956279 AGTTTGAAAGAAATGTGGTAAGG + Intronic
913345813 1:117810319-117810341 AGTTTTAAGACAATGGGGTAAGG - Intergenic
915098682 1:153483177-153483199 AATTTTTTTCAAATGGGGAAAGG - Intergenic
915395840 1:155583360-155583382 ATTTTTATAGAGATGGGGTCTGG - Intergenic
915795080 1:158722134-158722156 ATTTTAATACAAACGGTGTATGG + Intergenic
919525681 1:198647164-198647186 AGGGTTATACAAGTGGGATAGGG - Intronic
921311103 1:213844747-213844769 AGTTTTATATGAATGGAGAAAGG + Intergenic
1068096917 10:52502959-52502981 AGTTTTATATAAATGGAATCAGG + Intergenic
1069279145 10:66632250-66632272 AGTTTTATAAAAATGGGGAATGG + Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1073580155 10:104658124-104658146 ATTTTTAAAGAAATGGGGTAGGG + Intronic
1073709992 10:106025518-106025540 AGGATTATACAAATTGGGTCTGG + Intergenic
1073774889 10:106773991-106774013 GATATTCTACAAATGGGGTAAGG - Intronic
1076165011 10:128274650-128274672 AGTGTGAAACAAATGGGGGATGG - Intergenic
1077744013 11:4880337-4880359 AGTTTTTTAAAAATGAGGGATGG + Intronic
1078654314 11:13224027-13224049 AGTATAAGACAAATGGGGTTAGG + Intergenic
1081743699 11:45458372-45458394 AGAGTTTTGCAAATGGGGTAAGG - Intergenic
1084582675 11:70033714-70033736 TGATTTATACAAATGGCCTATGG - Intergenic
1086314579 11:85577702-85577724 ATTTTTTTAAAAATGAGGTAAGG + Intronic
1087144348 11:94797553-94797575 AGATATATACAAATGGAGTGGGG + Intronic
1089087763 11:115837688-115837710 AGTTTTTTAAAAATGGGTTTTGG - Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093760204 12:22901344-22901366 TGTTTTAAACAAATGGTGTTGGG + Intergenic
1094065411 12:26356570-26356592 AGTTTTACACAAATGGAGTGTGG + Intronic
1096899298 12:54858191-54858213 AGTTTTACCCAAATGGGTTGGGG + Exonic
1096991123 12:55804525-55804547 AGTTATATAAAAACTGGGTAAGG + Intronic
1099025033 12:77454837-77454859 AATTTTCTACTAATGGGGGAGGG + Intergenic
1100058654 12:90544256-90544278 ATCCTAATACAAATGGGGTAAGG - Intergenic
1100412066 12:94329438-94329460 TGTTTTATAGAGATGGGGTCTGG + Intronic
1104593759 12:130105335-130105357 AGTATTCTACAAATGAGGGAGGG + Intergenic
1106804456 13:33292030-33292052 ACTTTTATAATATTGGGGTAGGG - Intronic
1110463984 13:75780019-75780041 AGGAGTATACAAATAGGGTATGG + Intronic
1110468172 13:75827036-75827058 AGTTTGATTCCAATGGGGGAGGG - Intronic
1110807736 13:79777183-79777205 AATTTTAGAAAAATGAGGTATGG + Intergenic
1111043466 13:82783122-82783144 TGTTTTAAACAAATGAGGTTGGG - Intergenic
1113172477 13:107520808-107520830 ATTTTTCAACACATGGGGTAAGG + Intronic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1114732146 14:25004417-25004439 AGAATTATACACATGGGGGAGGG + Intronic
1115052264 14:29077612-29077634 ATTTTTATACAAATGGGTGATGG - Intergenic
1115793446 14:36905875-36905897 AGTTATATACAAATGGAAAAAGG + Intronic
1115922761 14:38394974-38394996 AGTTTTATTCAAATGAAATATGG - Intergenic
1116635471 14:47389249-47389271 AATGTTATACAAATGCTGTATGG + Intronic
1116643482 14:47496419-47496441 ATTTTTGTAGAAATGGGGTCAGG + Intronic
1118798029 14:69162348-69162370 AGTTTTATTCCAATGTGGTCAGG - Intergenic
1120688552 14:87566534-87566556 CGCTTAATACATATGGGGTAGGG + Intergenic
1121658365 14:95615420-95615442 AGATGTATACAAATGGTGTGAGG + Intergenic
1122010553 14:98743006-98743028 AGTTTTATAATAATGGGTTTTGG + Intergenic
1123822195 15:24042131-24042153 AGTTGCATAGAAATGGGGTCTGG - Intergenic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1126222451 15:46230091-46230113 AGTTTTTAACAAATGGCATAGGG + Intergenic
1126883571 15:53125318-53125340 AGTTATATATAAATGGTTTAAGG + Intergenic
1128503077 15:68243018-68243040 AGTTTTATATACAAGGTGTATGG + Intronic
1130333804 15:82941857-82941879 AGTATTATACCAATGTTGTAGGG - Intronic
1130372679 15:83299368-83299390 AATTTTAGAAAAATGGGGAAAGG - Intergenic
1130840129 15:87691496-87691518 AGTTTTTTAAAAATGGGCAAAGG + Intergenic
1132276753 15:100572903-100572925 GGATTAATACAAATGGGGTGGGG + Intronic
1134509437 16:14834322-14834344 AGTTTTAAAGAAATGGAGTCTGG - Intronic
1134697142 16:16233137-16233159 AGTTTTAAAGAAATGGAGTCTGG - Intronic
1134974703 16:18561548-18561570 AGTTTTAAAGAAATGGAGTCTGG + Intronic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1137332393 16:47511871-47511893 AGTTTTCCACGGATGGGGTAGGG + Intronic
1138310703 16:56021238-56021260 TGTTTTAATCAGATGGGGTATGG + Intergenic
1139115799 16:63950163-63950185 AGTTTTATTCAAATGGCGTCAGG + Intergenic
1140943752 16:79748280-79748302 TGTTATATACAAATTGGGTTGGG - Intergenic
1141787613 16:86212248-86212270 AATTTTATACATTTGGGGGAGGG + Intergenic
1144816210 17:18037276-18037298 AACTTTATAGAAATGGGGAAGGG - Intronic
1146567151 17:33923340-33923362 AGTTTCATATAAATGTGGTTGGG - Intronic
1148132745 17:45271789-45271811 TGTTTTTTAAAAATGGGGCAGGG + Intronic
1148188253 17:45660280-45660302 TGTTTTATGCAAATGTGGAAGGG - Intergenic
1148435990 17:47685684-47685706 AGTGTCCTACAAATGAGGTAAGG + Intergenic
1148692298 17:49536184-49536206 AGTTTTATATGAATGGGGCCAGG + Intergenic
1149487231 17:57052201-57052223 AGCTTTATACAAAAGGGTGAAGG + Intergenic
1149756974 17:59195009-59195031 ATTTGTATACAATTGGGGTCGGG + Intronic
1155887736 18:31228474-31228496 AATTTTAAAAAAATGAGGTATGG - Intergenic
1158586984 18:58748055-58748077 AGTTCTATACAAATGAAGTATGG + Exonic
1159659538 18:71077005-71077027 AGTCTTCTGGAAATGGGGTAGGG + Intergenic
1159775511 18:72599630-72599652 AGCTTTATAAAAATGGGCTCTGG - Intronic
1168548589 19:57274665-57274687 CGTCTTATACAAATAAGGTAAGG + Intergenic
925814212 2:7731910-7731932 ACATTTATAAAAAGGGGGTAAGG - Intergenic
926548610 2:14273137-14273159 AGTTTTCTCATAATGGGGTAGGG + Intergenic
926697150 2:15778822-15778844 AGTTTTAAACAAATGCACTATGG + Intergenic
926918794 2:17918812-17918834 AGGTGTACACAAATGGGCTATGG + Intronic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
928083382 2:28329295-28329317 AGTTTTATACAAATGGGGTAGGG - Intronic
928699276 2:33882245-33882267 AAATTTATACACATTGGGTATGG + Intergenic
928987955 2:37198832-37198854 ATTTTTATACAAATGGGGGCAGG - Intronic
929503268 2:42508247-42508269 AGATTTTTAAAAATAGGGTAAGG - Intronic
931867531 2:66428124-66428146 AGTTTTATTAAAATGCGATAAGG + Intergenic
934142142 2:89056818-89056840 AGTTTTATAGGATTTGGGTAGGG - Intergenic
935410094 2:102752396-102752418 ATTATTATACATATGTGGTATGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936656453 2:114493567-114493589 AGGTTTATCAAAATGGGGCATGG + Intronic
939227542 2:139382978-139383000 AGTTGTTTTCAAATGGGGCAGGG + Intergenic
939447596 2:142330203-142330225 TGTTTTATAGAAATTGGTTAAGG - Intergenic
940667711 2:156629005-156629027 AATTTTATTCAAATGAGTTACGG - Intergenic
942237068 2:173921233-173921255 ATTTGTATAAAAATGGGGGAAGG - Intronic
944959393 2:204853921-204853943 AGTTTTATATAAATAGAGTTAGG + Intronic
945317876 2:208390495-208390517 AGTCTTGTACAAATGGGCCATGG + Intronic
946358673 2:219205992-219206014 AATTTTGTAGAAATGGGGTTGGG - Intronic
948113704 2:235477739-235477761 GCTTTTATACAAAGGGGGTCAGG + Intergenic
1169984690 20:11430749-11430771 ATTTTTAAACAAATGGTGTAAGG + Intergenic
1170529211 20:17273113-17273135 AGTTTTATAAAAATTTGGTTTGG - Intronic
1170807617 20:19646794-19646816 AGTCTTATACAAATGTGATCGGG + Intronic
1172627254 20:36354308-36354330 TGTTTTCTACAGATGGGGTCTGG - Intronic
1173234290 20:41229922-41229944 ACTTTTATATATATGGTGTAAGG + Intronic
1174024239 20:47559449-47559471 TGTTTTGTACAAATGCAGTAGGG - Intronic
1174908790 20:54583256-54583278 AGTTTTATTCTATTGTGGTAAGG + Intronic
1175002129 20:55640886-55640908 TGTTTTAAAAAAATGGGGTGGGG + Intergenic
1177509660 21:22068909-22068931 AGTTTCATATAAATGTGGCATGG + Intergenic
1184053733 22:42029547-42029569 ATTTTTATAGAGATGGGGTCTGG + Intronic
952724232 3:36566265-36566287 AGTTTTATACAAAGGATGCAAGG - Intergenic
953084578 3:39654259-39654281 AGTTTTATTAAAATGTGGTGAGG - Intergenic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
956365727 3:68500412-68500434 AGTTTTATAACAATTGGGCAGGG - Intronic
959839917 3:110963658-110963680 AGTTTTTTAAAAATGAGGTTAGG + Intergenic
960231301 3:115230406-115230428 GGCTTTATATAAATGGAGTAAGG + Intergenic
960302102 3:116015753-116015775 AGTTTAAAAAAAATTGGGTAAGG - Intronic
960440940 3:117687891-117687913 AGTTTAATAAAAATGAGGTAGGG + Intergenic
960993979 3:123329175-123329197 AGCATTATACAAATAGGGTTTGG - Intronic
962300638 3:134239305-134239327 ATTTTTATATTAGTGGGGTATGG + Intronic
962420366 3:135223255-135223277 AGTTTTATAGGAATGGGCCAGGG + Intronic
963096145 3:141543332-141543354 AGTATATTACAAATGGGGGAGGG - Intronic
963743151 3:149099003-149099025 AAGTTTATAAAAATAGGGTAAGG + Intergenic
964271896 3:154965687-154965709 AGTTTTCTAGAAATAGGGTGTGG - Intergenic
964312952 3:155413881-155413903 ATGTTTATACAAATGGTGTGTGG - Intronic
964494392 3:157272640-157272662 ATTTTTGTAGAAATGGGGTTAGG + Intronic
965075793 3:163973993-163974015 AGTTTTATATAAAAGTAGTAAGG + Intergenic
966780605 3:183580953-183580975 AGATTTCTGCAAATGGGGCAGGG + Intergenic
968665502 4:1819676-1819698 CGCTTTAAACAAATGGGGTTTGG - Intronic
972229893 4:37059472-37059494 AGTTTTATTCAAAAGCTGTAGGG + Intergenic
972787749 4:42343516-42343538 ACTTTTAAACAAATGGTGTGGGG + Intergenic
974554559 4:63427947-63427969 AATTTTATATAAATGGTATAAGG + Intergenic
978329900 4:107601077-107601099 AATTTAATACAAATGGGCCAAGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
982312355 4:153999162-153999184 AGTTTTATACCATTTTGGTATGG + Intergenic
986593620 5:9397023-9397045 AGTTCTATACAAATGGAACAAGG + Intronic
987690442 5:21259589-21259611 AGTTTTTTTCAAAAGGGGGAAGG - Intergenic
988295734 5:29359105-29359127 AATTTTATATAAATAGGATATGG + Intergenic
989808437 5:45641517-45641539 AGTTCTATACAAAGGAGGTTGGG + Intronic
990811785 5:59733923-59733945 AGTTTTGAACCAATGGGTTAAGG + Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992679356 5:79138488-79138510 AGTATTAAACAAATGGTGTTGGG + Intronic
993171209 5:84421216-84421238 AGATTTATACAACTGGGGGAGGG + Intergenic
993926538 5:93873052-93873074 AGATTTATACAAATAGGCAAAGG + Intronic
994079287 5:95688427-95688449 ATTTTTATAGAGATGGGGTCTGG + Intronic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996203701 5:120704143-120704165 AGCTTTTTAAAAAAGGGGTATGG + Intergenic
998698629 5:144670695-144670717 AGTGTTCTTTAAATGGGGTAAGG + Intergenic
1000518314 5:162268163-162268185 ACTTTTATAAAAATTGTGTAAGG + Intergenic
1000605335 5:163321500-163321522 AGTTGGATACAAATTGAGTATGG - Intergenic
1003901994 6:10662992-10663014 AGTTTTCCAGAAAAGGGGTAGGG - Intergenic
1004338431 6:14785178-14785200 TGCTTTAAACAAATGGGGGAAGG + Intergenic
1004756078 6:18611824-18611846 ATATTTATACAAATAGGCTAGGG - Intergenic
1005135703 6:22568301-22568323 AGTTTTACTGAAATGGGTTAAGG + Intergenic
1005532439 6:26721559-26721581 AGTTTTCTAAAAATGGGGTGGGG - Intergenic
1005535961 6:26756035-26756057 AGTTTTCTAAAAATGGGGTGGGG + Intergenic
1005538356 6:26780106-26780128 AGTTTTCTAAAAATGGGGTGGGG + Intergenic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1009006996 6:57799694-57799716 AGTTTTCTAAAAATGGGGTGGGG + Intergenic
1009009209 6:57822456-57822478 AGCTTTCTAAAAATGGGGTGGGG + Intergenic
1010728275 6:79360307-79360329 TGTTTTATACAAATGCAGTCAGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011671670 6:89689307-89689329 AGGTATAAACAAATGGTGTAGGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1012779477 6:103539263-103539285 TGTTTTATACAAATTGTATAAGG + Intergenic
1015112252 6:129606523-129606545 AGTATTACTTAAATGGGGTAAGG - Intronic
1016480842 6:144479591-144479613 AGTATTATCCAAATGTGGTGTGG + Intronic
1016630301 6:146221813-146221835 ATTTGTATACAAATGGTTTATGG - Intronic
1017700765 6:157067928-157067950 GGTCTTAAACATATGGGGTATGG - Intronic
1019887942 7:3921786-3921808 ATTTTTATAGAGATGGGGTCTGG - Intronic
1020799690 7:12718291-12718313 ATTTTTATAGAAATGGGGTTTGG + Intergenic
1022362291 7:29673154-29673176 AGATTTATACAAATGAGGGAGGG + Intergenic
1022428995 7:30297155-30297177 AGATTTATACAAATGAGGGAGGG - Intronic
1022699105 7:32740591-32740613 AGATTTATACAAATGAGGGAGGG - Intergenic
1023574764 7:41615367-41615389 AGTTATTTACAAATGGTGTTTGG + Intergenic
1026661490 7:72306770-72306792 AGTTTTATACATATTAGGGAGGG - Intronic
1027856491 7:83518452-83518474 AGTTGTATAGAAATGGGCTTTGG + Intronic
1028010957 7:85643133-85643155 AGTTTTATACATATCAGGTCAGG - Intergenic
1030109614 7:106015652-106015674 AGAATTAGACAAATGGGGCAGGG - Intronic
1031665922 7:124481849-124481871 AGCTTTCTCCATATGGGGTAAGG + Intergenic
1033360160 7:140633339-140633361 ATTTTTATAGAGATGGGGTTTGG + Intronic
1035794807 8:2345332-2345354 AGTTTTATAGAAATGGGATGTGG + Intergenic
1038873466 8:31521480-31521502 AGTTTTTTAGAAACAGGGTAGGG + Intergenic
1039805798 8:40996813-40996835 TGTTTTAAACAAACGGGGTTAGG - Intergenic
1041182143 8:55259930-55259952 AGTTTTATACACAAGGGGTGGGG - Intronic
1041457131 8:58073317-58073339 AGTTTTTTAGAAAGGGGGTGAGG + Intronic
1042846663 8:73175541-73175563 AGTTTTAAAAAAATAGAGTATGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1045132763 8:99175579-99175601 ATTTTTCTAGAAATGGGGTCTGG - Intronic
1048098177 8:131317182-131317204 AGTTTTAGAAAAAAAGGGTAGGG + Intergenic
1049656320 8:143799993-143800015 AGTTTCAGAAAAATGGGGAAGGG + Intronic
1050058954 9:1685362-1685384 GCTCTTATACAAATAGGGTATGG + Intergenic
1050214347 9:3305700-3305722 AGTTTTATGCATATGGGGAGAGG + Intronic
1050934205 9:11374201-11374223 AGTATTATAAAAATTGAGTAGGG + Intergenic
1051431061 9:16980940-16980962 AGATTTTTAAGAATGGGGTAAGG - Intergenic
1051699906 9:19810688-19810710 AGTTGTATACAAAAGAGCTATGG - Intergenic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055804742 9:80079900-80079922 AATTTTATACAAATTGGCCAAGG + Intergenic
1058154965 9:101504786-101504808 ACTTTTATTCTAATGGGCTAAGG + Intronic
1060007071 9:120009893-120009915 TATTTTATATAAATGGGATAAGG + Intergenic
1186955964 X:14682350-14682372 TGTTTTAGACAAATAGTGTAAGG + Intronic
1187460222 X:19479871-19479893 AGTTCTATACAAATGGCTTCTGG - Intronic
1189524329 X:41803706-41803728 AATATTATAAAAATGGGGAAGGG + Intronic
1192093961 X:68190389-68190411 AGTTTCATACATTTGGGGCAGGG + Intronic
1192683184 X:73274973-73274995 AGTATTAAACAAATGAGGGAAGG + Intergenic
1193352790 X:80481927-80481949 AGTCTTGTACAAATGGGCCATGG - Intergenic
1193405525 X:81096453-81096475 AGTTTTAAACAAAAGGGCTCAGG + Intergenic
1193682132 X:84534793-84534815 ACTTTTATACCATTGGTGTATGG + Intergenic
1193702602 X:84780892-84780914 AGTTTTAAACTAATGTAGTATGG + Intergenic
1194858401 X:98962775-98962797 AGTTTTATCCAGATTGGGTGGGG - Intergenic
1196912832 X:120501270-120501292 AATCCTATAGAAATGGGGTAAGG - Intergenic
1198995628 X:142570944-142570966 AGATTTACATAAATGGGGTGAGG + Intergenic