ID: 928083678

View in Genome Browser
Species Human (GRCh38)
Location 2:28332373-28332395
Sequence GTGGCTTGCTCAAGATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1099
Summary {0: 1, 1: 8, 2: 44, 3: 220, 4: 826}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928083678 Original CRISPR GTGGCTTGCTCAAGATCACA TGG Intronic
900850776 1:5141217-5141239 GTGACTCGCTGAAGGTCACAGGG + Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901801925 1:11713266-11713288 CTGTCTTGCCCAAGGTCACACGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902115323 1:14116445-14116467 CTGGCAGGCTCAACATCACATGG - Intergenic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902479486 1:16704233-16704255 GTGGCTTGGCCAAGATCCCACGG - Intergenic
902525313 1:17053661-17053683 TTGAATTGCTCAAGGTCACATGG - Intronic
902529478 1:17081381-17081403 ATTGCTTGCCCAAGGTCACATGG + Intronic
902596230 1:17511408-17511430 GTGGCTTTCCCAAAGTCACAGGG + Intergenic
902677652 1:18019997-18020019 GTGACTTGCACAACATCCCACGG - Intergenic
902775082 1:18669483-18669505 GTGACTTGCTAGAGGTCACACGG - Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
903030401 1:20459793-20459815 ATGCCTTGCCCAAGGTCACATGG - Intergenic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903301258 1:22380159-22380181 GTCCCTTGCCCAAGGTCACAAGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903345103 1:22679536-22679558 GTGGCTCACTGAAGATCACTTGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903461237 1:23522242-23522264 GTGACTTGCTTAAGGTCTCACGG + Intronic
903496240 1:23769514-23769536 GTGACATGCTCAAGTCCACATGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903953349 1:27009310-27009332 GTCACTTGCACAAGATCACGTGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904208353 1:28869611-28869633 ATGACTTGCCCAAGACCACATGG + Intergenic
904318691 1:29682542-29682564 GTGGCTTCTTCAAGGTCATATGG + Intergenic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904584372 1:31571691-31571713 CTGGCTTGTCCAAGGTCACACGG - Intergenic
904703856 1:32375900-32375922 GTAACTTGCCCAAGTTCACATGG - Intronic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905334264 1:37233348-37233370 GCGGCTTGCTCAAGGTCATTTGG - Intergenic
905406927 1:37740002-37740024 GAGGCTTGCCCAAGACCAGAAGG + Intronic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905835463 1:41116410-41116432 GGAGCTTGCTCAAGATCACGTGG - Intronic
905850154 1:41267995-41268017 GTGACTTGCTTAAGGTCACTGGG - Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
905894426 1:41535792-41535814 GTGTCTTGCCCAAAGTCACAAGG + Intronic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906515750 1:46437894-46437916 AAGGCTAGCCCAAGATCACATGG - Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906686220 1:47765152-47765174 GTGGGTAGCCCAAGGTCACACGG - Exonic
906949244 1:50321093-50321115 GTCACTTGCCCAAGTTCACATGG + Intergenic
907156669 1:52341258-52341280 TTAACTTGCTCAAGATTACAAGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907408996 1:54271720-54271742 GTTTCTTGCTCAAGACCAAATGG - Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
907608015 1:55839110-55839132 GTGGCTATCTCAAGATCAAAGGG - Intergenic
907718844 1:56952722-56952744 TTGGCTTGCCCAAGGTCACCTGG - Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908358509 1:63345236-63345258 GTGACTTGCTCAAAGGCACATGG - Intergenic
908553611 1:65234568-65234590 TTGCCTTGCTCAGGACCACAAGG + Intergenic
909420151 1:75455223-75455245 TTGACTTGCTGAAGATCATATGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
910106331 1:83634848-83634870 ATGACTTGCTCAAGGTCGCATGG + Intergenic
910262143 1:85303241-85303263 CTGGCTTGCTCACCATCACATGG - Intergenic
911238446 1:95437702-95437724 GGGGCTGGCTTAAGACCACAGGG - Intergenic
911244497 1:95501733-95501755 GTGACTTGCTCAGAGTCACATGG - Intergenic
911287135 1:96009491-96009513 TTGACTTGTTCAAGATCTCAAGG - Intergenic
911452077 1:98075770-98075792 GTGGTTTGCCCAGGGTCACATGG + Intergenic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912713028 1:111963034-111963056 GTGGCCTGCTCAAGATCTCCTGG - Intronic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913117958 1:115713885-115713907 GTGGCATGTTCGGGATCACAGGG - Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
913380561 1:118205779-118205801 GTGGCCATCTCAACATCACAGGG + Intergenic
913595166 1:120368787-120368809 GTGGCTGGTTCAATAACACATGG - Intergenic
913681450 1:121189594-121189616 GAGGCTTGTCCAAGGTCACACGG + Intronic
914033281 1:143977231-143977253 GAGGCTTGTCCAAGGTCACACGG + Intergenic
914092106 1:144510200-144510222 GTGGCTGGTTCAATAACACATGG + Intergenic
914156165 1:145090736-145090758 GAGGCTTGTCCAAGGTCACACGG - Intronic
914306428 1:146423664-146423686 GTGGCTGGTTCAATAACACATGG - Intergenic
914433180 1:147638343-147638365 GTCACTTGCTCAAGGTCATATGG + Intronic
914595620 1:149149137-149149159 GTGGCTGGTTCAATAACACATGG + Intergenic
915294816 1:154912473-154912495 GTGGTTTGCTCAAGGTCAAGCGG - Intergenic
915459901 1:156063774-156063796 ATGACTTGCCCAAGATAACAGGG - Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916591579 1:166195856-166195878 GTGACTTGCCCACAATCACATGG - Intergenic
916592026 1:166201096-166201118 GTGGCTTGCCCAAGTTCACATGG - Intergenic
916610967 1:166391115-166391137 CTGACTTTTTCAAGATCACATGG - Intergenic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
918031570 1:180818430-180818452 GTTCCTTGCCCAGGATCACAAGG - Intronic
918084848 1:181236900-181236922 GTGATTTGTGCAAGATCACATGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
918828576 1:189360417-189360439 ATGTCTTGTTCAAGGTCACATGG + Intergenic
919083967 1:192898951-192898973 GTGAGTTGCTTATGATCACAAGG + Intergenic
919337437 1:196255331-196255353 GTGACTTGCCAAAGAACACACGG + Intronic
919528787 1:198688913-198688935 GTGTCTTGGCCAAGTTCACAAGG - Intronic
920257906 1:204668656-204668678 GTGGCTTGCCCACAGTCACATGG - Intronic
920430659 1:205916691-205916713 GTGGCTTGCTCAGGGTCACGTGG + Intronic
920468764 1:206208112-206208134 GAGGCTTGTCCAAGGTCACACGG + Intronic
920678878 1:208057973-208057995 GTGACTTGCTCAAAGTCACCTGG + Intronic
920759637 1:208769983-208770005 ATGGCTTGCCCAAAGTCACAGGG + Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921279732 1:213554303-213554325 TTGTCTTGTTGAAGATCACATGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921763173 1:218940540-218940562 CTGGCAGGCTCAAGATCACATGG - Intergenic
921795141 1:219334211-219334233 GAGGGTTGCTCAAAGTCACAAGG - Intergenic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922084312 1:222331360-222331382 GTAACTTGTCCAAGATCACAAGG + Intergenic
922175884 1:223197262-223197284 GTGGCTTGTTGAAGGTCATATGG + Intergenic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923196339 1:231671772-231671794 GTAGCTTGCCCAACCTCACATGG - Intronic
923897475 1:238288135-238288157 TTGGATTGCTTAAGATGACATGG + Intergenic
1063170322 10:3504001-3504023 GTGACTTGCTCAAAATAATACGG - Intergenic
1063215053 10:3916988-3917010 GTAACTTGCTCAAAATCTCATGG + Intergenic
1063334359 10:5197421-5197443 GTGTCATGCTCAAGACCACGCGG - Intronic
1064186751 10:13168465-13168487 GGGGCTTGTTCAGGATCACATGG - Intronic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066415395 10:35216604-35216626 GTAGCTTGCCAAAGGTCACATGG + Intergenic
1066456001 10:35572787-35572809 GTGAGTCGCTCAAGAACACAGGG - Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067427638 10:46221687-46221709 GTTGCCAGCTCATGATCACAAGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067583060 10:47457600-47457622 GTTGCTGGCTCATGATCACCCGG - Intergenic
1067915144 10:50389502-50389524 GTGTTTTACTTAAGATCACAAGG + Intronic
1068530159 10:58176479-58176501 GTGGTTTGCTCAAGGTCACGTGG + Intergenic
1069274422 10:66571486-66571508 GTGGCTTACTCAAAGGCACATGG + Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070567804 10:77616912-77616934 GTGGCTTGCCCAAGATCCAAAGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070726560 10:78795470-78795492 GTAGCTTGCTCAAGGCCACTTGG - Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070774506 10:79101940-79101962 GTGGCCAGCTCCAGGTCACACGG + Intronic
1070795184 10:79212113-79212135 GTGACTTGCTTAAGGTCACGTGG - Intronic
1071356444 10:84801027-84801049 GTTGCTCTCTCAAGATCACAGGG - Intergenic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1072212787 10:93261945-93261967 CTGACTTGCTCAAGAACACGTGG + Intergenic
1072213518 10:93268628-93268650 GTGTCTTGCTCAAAGTCAGAGGG - Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072555287 10:96510073-96510095 ATGACTTGCTCAAGGCCACACGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073562966 10:104512537-104512559 GTGGCCAGCTCAAGGCCACACGG + Intergenic
1073604638 10:104881821-104881843 GTGGCTTCTCCAAGGTCACATGG - Intronic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074183323 10:111081707-111081729 GCGACTTGCTCAGGATCCCAAGG + Intergenic
1074299812 10:112223543-112223565 GTGATTTGCTTAAGGTCACAAGG - Intergenic
1074355583 10:112780704-112780726 GTGGCTTTCTCAAAGCCACATGG + Intronic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1074932539 10:118143671-118143693 GTGGCTTGTCCCAGGTCACACGG + Intergenic
1074944433 10:118267850-118267872 GTGTCTTGTCCAAGATCACAAGG + Intergenic
1074993260 10:118731302-118731324 GTGACTTCCTCAAGAACTCAAGG + Intronic
1075050266 10:119178444-119178466 GGCGCTTGCCCAAGATCACAGGG + Intronic
1075098814 10:119491354-119491376 ATGGCTTACGCAAGCTCACAGGG + Intergenic
1075277465 10:121107180-121107202 ATGGTGTGCACAAGATCACAGGG + Intergenic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1076391945 10:130110137-130110159 GAGACTTGCACAAGATCCCAGGG - Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076432932 10:130419746-130419768 GTGGCTGGCTCCTGGTCACAGGG - Intergenic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077913647 11:6596397-6596419 GAGGCCTGGGCAAGATCACACGG + Exonic
1078196393 11:9140320-9140342 GTAGCTTGTCCAAGATCACATGG + Intronic
1078748089 11:14134490-14134512 GTGGTTTGGTGAAGATCACATGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1078927248 11:15885968-15885990 GTGGCGTGCCCAAGGCCACAGGG + Intergenic
1079141506 11:17813340-17813362 GTGACTTGCTCATGATCATGTGG + Intronic
1079351857 11:19698474-19698496 GTGGCTTTCCCAAGGTCACCCGG + Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1079989576 11:27232636-27232658 GTGACTTGCTCATGGTCACTTGG + Intergenic
1080332110 11:31151141-31151163 GTAGCATGCTCATGAACACAAGG + Intronic
1080576878 11:33607969-33607991 GTGGCTTGTTCAAAGTCACACGG + Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083308070 11:61771099-61771121 GTGGCTTGTTTCTGATCACAGGG + Intronic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083622016 11:64053829-64053851 GGGGAGTGCTCAAGGTCACATGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083774250 11:64885726-64885748 GTGCCTTGCTAAAGATCATATGG - Intronic
1084433110 11:69122469-69122491 GTGGCTTGCCCCAGGTCGCACGG + Intergenic
1084439604 11:69165084-69165106 GGGGCTTGATCACGATCACGTGG - Intergenic
1084569532 11:69951097-69951119 GCTGCTTGCTCAAGCTCCCACGG + Intergenic
1084588430 11:70076986-70077008 GAGGCTGGCACAAGGTCACAAGG + Intergenic
1084716813 11:70879509-70879531 GTGGCTGGTCCAAGACCACACGG + Intronic
1085170763 11:74448119-74448141 GTGGGTTGCCCAAGGTCACATGG - Intergenic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085408160 11:76276324-76276346 GTGCCTTGCCTAAGGTCACATGG + Intergenic
1085740814 11:79076945-79076967 CTGGCTTGCTCTAGATCACGTGG + Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1085790739 11:79495256-79495278 ATAGCTTGTTCAAGGTCACACGG + Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1086234119 11:84607348-84607370 GTGGCTTTCTCAACTTTACAGGG - Intronic
1086916566 11:92536430-92536452 GTCACTTGCCCAACATCACATGG - Intronic
1086996621 11:93364944-93364966 GAGGAATGCTCAAGAACACAGGG - Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088455244 11:110026604-110026626 GTTGCTTGCTGAAGATAACATGG + Intergenic
1089074903 11:115729988-115730010 GTGGTTTGCTCAGGATTGCAGGG - Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089203424 11:116739394-116739416 GGGGCTTCCTCAAGGTCTCATGG + Intergenic
1089511979 11:119004968-119004990 GAGGATTGCTTAAGCTCACAAGG + Intronic
1089529585 11:119117828-119117850 GTTGCCTGCTCAAGATCACTTGG - Exonic
1089584538 11:119502178-119502200 GTGGCTTGCTCAAGGTTCCTCGG + Intergenic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1089614634 11:119688358-119688380 GGGGTCTGCTCAGGATCACAGGG - Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090471890 11:126988437-126988459 GTGGCTTGCTGATGGTCACACGG + Intronic
1090499678 11:127249158-127249180 GTGATTTGCACAAGCTCACATGG - Intergenic
1090698579 11:129273754-129273776 ATGGCTTGCTTCACATCACAAGG + Intronic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091281672 11:134385051-134385073 GCAGCTTGCTCAAGGGCACAGGG - Intronic
1091481320 12:834616-834638 GTGAATTGCTCAAGATCGTATGG - Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091950703 12:4590819-4590841 GTGACTTGCCCAGGAGCACATGG - Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1093212303 12:16322685-16322707 TAGTTTTGCTCAAGATCACACGG + Intergenic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1095762780 12:45858725-45858747 GTCGGTAGCCCAAGATCACATGG + Intronic
1096244788 12:49978399-49978421 TTGACTTGCTCAAGGTCACCTGG + Intronic
1096302091 12:50438734-50438756 GTAGCTTGCTCAAGGATACAAGG + Intronic
1096676326 12:53228072-53228094 GTGACTGGCTTAAGGTCACATGG + Intronic
1097202018 12:57287136-57287158 GTGGCTAGCCCAAGTTTACATGG - Intronic
1097263000 12:57729986-57730008 GTGCCTTGCTCAAGGTCTTAAGG - Intronic
1097289549 12:57902872-57902894 CTGACTTGCTCCAGGTCACAGGG + Intergenic
1097328167 12:58302848-58302870 TTGGCTTGCTGAAGACCACATGG + Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1098146743 12:67505199-67505221 GTCTCTTGCCCAAGATCCCACGG + Intergenic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098870239 12:75809280-75809302 GAGTCTTGCTCAAGACCACATGG + Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1099093415 12:78341334-78341356 CAGGCTTGATCAAGGTCACAAGG - Intergenic
1099156617 12:79184493-79184515 GTGGCTTGCTGATGGTCACATGG - Intronic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101060510 12:100966368-100966390 ATAGCTTGTTCAAGATCACAGGG + Intronic
1101116028 12:101532136-101532158 GGTACTTGCTCAAGATCATATGG - Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101718188 12:107329298-107329320 CTGACTTGCCCAAGATCACCTGG - Intronic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG + Intronic
1102007754 12:109599283-109599305 CTGTCTTGCCCAAGGTCACATGG - Intergenic
1102068788 12:110000247-110000269 ATGCCTTGCCCAAGGTCACAGGG - Intronic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102196553 12:111029459-111029481 GTGGTTGGCTCATGGTCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102409194 12:112702522-112702544 GTGGCTTGCCCAAGCCCACATGG + Intronic
1102464144 12:113118710-113118732 GTGGCTTTTTCAAGGTCATATGG - Intronic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102626794 12:114241658-114241680 GTGTCTTGCTTAAGGTCCCACGG - Intergenic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102788070 12:115620310-115620332 GTTGCCTGCCCAAGACCACAGGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103231805 12:119337395-119337417 GCAGCTTGCCCAAGACCACAGGG - Intronic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103532357 12:121611399-121611421 TAGCCTTGCTCCAGATCACAGGG + Intergenic
1103555319 12:121762858-121762880 ATGGCTTGCCCAGGGTCACAGGG - Intronic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104360921 12:128132509-128132531 GTGGCCTGTCCAAGATCACACGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105506286 13:21013110-21013132 GTGGCATGCCCATGAGCACAGGG - Intronic
1106130141 13:26933037-26933059 GTGGCCCCCTCAAGACCACATGG - Intergenic
1106295581 13:28410830-28410852 ATGCTTTGCTCAAGTTCACAGGG + Intronic
1106405417 13:29469128-29469150 GTGCCTTGCTGAAGCTCCCATGG + Intronic
1106516048 13:30455049-30455071 GAGGCTTGCTCAAGGACAAATGG - Intergenic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106997813 13:35508104-35508126 GTAATTTGCTTAAGATCACAGGG + Intronic
1107064647 13:36200079-36200101 GTGACTTGCCTAAGACCACATGG - Intronic
1108005371 13:45941047-45941069 GTGATTTGCTCAAGGTCAAACGG - Intergenic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1109168739 13:59069485-59069507 GTGGCCTGCTCCAAATCACAAGG + Intergenic
1109697531 13:65979424-65979446 GTGTCTTGCCCAAGGTTACACGG - Intergenic
1109956150 13:69569114-69569136 TTGGCTTACTCAACATCATATGG + Intergenic
1110136293 13:72071443-72071465 GTAACTTGCCCAAGCTCACACGG + Intergenic
1110313760 13:74081182-74081204 GTATCTTGCTTAAGATCACCTGG - Intronic
1110617662 13:77559143-77559165 GTGGCTTTCCTAAGACCACAAGG - Intronic
1112817302 13:103287882-103287904 GTGGTTTTCTCAAAACCACAAGG - Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115519836 14:34222192-34222214 ATGACTTGCCCAAGATCATAGGG + Intronic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1115756476 14:36531340-36531362 GTAAATTGCTGAAGATCACATGG + Intergenic
1116425601 14:44786612-44786634 GTGGCCTGCTCTATATCCCATGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1118241825 14:64067360-64067382 GTAACTTGCTCAAATTCACAAGG + Intronic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118649692 14:67877329-67877351 GTGATTTGCCCAAGATCATATGG + Intronic
1118715914 14:68559979-68560001 GTGGCTTGTCCAAGTCCACATGG + Intronic
1118920919 14:70149380-70149402 GGGTCTTGCTCCAGATCACTTGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119306416 14:73611728-73611750 GTTTCTTGCTAAAGATCACCAGG + Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119690640 14:76669358-76669380 CTGACTTGTTCAAGGTCACAGGG - Intergenic
1119931884 14:78555596-78555618 ATGATTTGTTCAAGATCACAAGG - Intronic
1119936742 14:78598933-78598955 CTGGATTGCTGAAGATCATATGG + Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120341964 14:83232473-83232495 GTGACTTGGTCAAGGTCATATGG - Intergenic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120786136 14:88538775-88538797 GTGACTTGCTCATGGTTACATGG - Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1120886708 14:89457472-89457494 GTAGCTTGCCCAAGGTCATACGG - Intronic
1120913633 14:89690429-89690451 GTAGGTTGCCCAAGGTCACATGG + Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121252808 14:92512681-92512703 GTGACTTGCTCAAGGCCATATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121507710 14:94489451-94489473 GTGGTTTGCCCAGGATCACGGGG + Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1121855749 14:97268705-97268727 GTGGCTTACTCAAGTTTGCACGG + Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1123199372 14:106647593-106647615 TTTCCTTGCTGAAGATCACAGGG - Intergenic
1124354226 15:28983553-28983575 GTGGCATGCTGAAGCTCCCAAGG + Intronic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1125381778 15:39093301-39093323 GTGGCTTGACCAAGATAATATGG - Intergenic
1125423117 15:39524536-39524558 GTGACTTGCCCTAGATCACCTGG + Intergenic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1126981222 15:54245860-54245882 GTGGCTTACATAATATCACAAGG + Intronic
1127123094 15:55787945-55787967 GTGGCTTGCCTGAGATCACATGG + Intergenic
1127202251 15:56667764-56667786 GTTCCTTGTTCAAGGTCACATGG - Intronic
1127314309 15:57780032-57780054 ATGGCTTGCACAAGATCAGCCGG - Intronic
1127689271 15:61378456-61378478 GTGATTTGCTCAAGCTCATATGG + Intergenic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1127969208 15:63945681-63945703 GTGGCCTGCTTAAGCTCACATGG - Intronic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128381645 15:67117511-67117533 GTGGCTTCCTCATGATCAAAAGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128885525 15:71283300-71283322 GTTGCTTGGTCAAGCTCATATGG + Intronic
1129165178 15:73773122-73773144 AGGGCTTGCCCAAGGTCACACGG + Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129360339 15:75020324-75020346 CTGGCTTGCTCTTGGTCACAGGG + Exonic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1129857608 15:78835800-78835822 GTTACTTGCTTAAGGTCACAGGG - Intronic
1130103374 15:80911040-80911062 ATGACTGGCCCAAGATCACATGG - Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130416907 15:83702634-83702656 GTTGCAGGCTCAACATCACAAGG - Intronic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1130719726 15:86374823-86374845 GTGACTGGCTCAAGATAATATGG - Intronic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131439891 15:92451802-92451824 GTAACTTGCACAAGATCCCACGG + Intronic
1132070897 15:98775739-98775761 GTTGCTTGTTAAAGCTCACAGGG + Intronic
1132153853 15:99481445-99481467 GTGCCTTGCCCAGGATCAAATGG + Intergenic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133888532 16:9855211-9855233 GTGGCTTGTTCAAGGTCACATGG - Intronic
1133974681 16:10592049-10592071 TTGACTTGCTCAAGGGCACATGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134179929 16:12039350-12039372 GTGACTTGCTCAAGGTCATTTGG + Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134684900 16:16151777-16151799 GTGGCTTGACCAAGGTCTCAAGG + Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135176075 16:20230460-20230482 GTGACTGGCCCAAGATCCCATGG - Intergenic
1135306674 16:21373117-21373139 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136060596 16:27723724-27723746 GTGGCTTGCACGAGACCACATGG + Intronic
1136303416 16:29352259-29352281 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1136656401 16:31711782-31711804 GTGGCTCCCTCAGGCTCACAGGG - Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137539745 16:49354085-49354107 GAGGCTTGCCCAAGTGCACATGG - Intergenic
1137571144 16:49567140-49567162 GAGACTTGCCAAAGATCACAAGG + Intronic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1138305084 16:55966980-55967002 GTGGCTTGCTCAGTTTCCCATGG + Intergenic
1138445800 16:57062548-57062570 GTGGCTTTCTCATGATGTCATGG + Intronic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139268613 16:65661925-65661947 GTGGCTTGCCGAAGGTCACATGG - Intergenic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1139407520 16:66730808-66730830 CTGGCCAGCTCAACATCACAGGG + Intronic
1139429442 16:66903388-66903410 TTGACTTGCCCAAGATCACGAGG + Intergenic
1140035251 16:71366896-71366918 TTGACTTGCCCAACATCACATGG + Intronic
1140069632 16:71638013-71638035 ATGGCTTGGCCAAGATGACAAGG + Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140713442 16:77699910-77699932 GTAGCTTGCCCAAAGTCACACGG + Intergenic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140959976 16:79902424-79902446 GTGGCTCACTCAAGGCCACAGGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141283459 16:82649806-82649828 GGGGTTTGCTCAAGGTTACAGGG - Intronic
1141322563 16:83025641-83025663 GTGGTTTGCCCAACGTCACAGGG + Intronic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1142480288 17:214807-214829 GGGGTCTGCTCAAGGTCACATGG + Intronic
1142616833 17:1141406-1141428 GTAGCTTGCCCAAGGTCACATGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143355305 17:6323565-6323587 GTCACTTGCTGAAGGTCACAGGG + Intergenic
1143623215 17:8093035-8093057 GGGACTTGCTCAAGATCAGCTGG + Intergenic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144167996 17:12631483-12631505 GTGGCATGGTCAAGTACACAAGG - Intergenic
1144168818 17:12638560-12638582 GTGTCTTGGCCAAGATCACATGG + Intergenic
1144224762 17:13134240-13134262 GTGACTTGTGCAAGGTCACATGG + Intergenic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1144824699 17:18099236-18099258 ATCACTTGCCCAAGATCACAAGG - Intronic
1144968517 17:19092749-19092771 GTGGCTTGCCACAGACCACATGG - Intergenic
1144979400 17:19159314-19159336 GTGGCTTGCCACAGACCACATGG + Intergenic
1144988822 17:19218918-19218940 GTGGCTTGCCACAGACCACATGG - Intronic
1145088799 17:19968737-19968759 GTAACTTGTCCAAGATCACATGG - Intronic
1145817131 17:27803599-27803621 GTGGCTTTTCCAAGATCACATGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146266989 17:31459285-31459307 GTGCTTTGCCCAAGACCACATGG - Intronic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146713999 17:35068424-35068446 GTGGCTTGTTAAAGATTAAAGGG - Intronic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1146944921 17:36866983-36867005 GTGACTTGCTCAAGGTCCCTTGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147499890 17:40952914-40952936 GTAACTTGCCCAAGATCTCATGG + Intergenic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147638357 17:41978102-41978124 GTAACTTGCCCACGATCACATGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147833662 17:43314961-43314983 GCAGCTTGCCCAAGACCACAGGG - Intergenic
1147931830 17:43986557-43986579 GTGGCTTGCTGAAAATCAGTGGG - Intronic
1148152267 17:45403860-45403882 GTGACTTGCTCAAGGTCCCTCGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1148907308 17:50919646-50919668 GTGTCTTGCTCAAAGTCACCTGG + Intergenic
1148987670 17:51637738-51637760 GTGGGCTGCCCAAGGTCACAGGG + Intronic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149088589 17:52751052-52751074 CTGGCTCCCTCAAGAGCACAGGG - Intergenic
1149311234 17:55395996-55396018 GTGGCCTGAACAAAATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1149541731 17:57472593-57472615 GGGGCTTGCTCAAGGTCATGAGG - Intronic
1149564832 17:57633684-57633706 ATGACTTGCTCAAGGCCACATGG - Intronic
1149609529 17:57949938-57949960 ATAACTTGCCCAAGATCACATGG - Intronic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1150118371 17:62576193-62576215 TTTGCTTGCGCAAGGTCACATGG + Intronic
1150439783 17:65181741-65181763 AGAGCTTGCCCAAGATCACATGG - Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1151146716 17:72047977-72047999 GTTACTTGTCCAAGATCACAGGG - Intergenic
1151880017 17:76889211-76889233 GTGGCTTTCCCAAGGTCACACGG - Intronic
1152265666 17:79293225-79293247 GTGACCTGCTCAAGCCCACATGG + Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1155219760 18:23673517-23673539 GTGGCTTGCTTCAACTCACACGG + Intergenic
1155353202 18:24926622-24926644 TTGCCTTGCTCAAGATACCAGGG - Intergenic
1155518847 18:26649359-26649381 GTGGATTGCACCAGATAACAAGG + Intronic
1155557915 18:27042268-27042290 GTGACTTGGTCAAGGTCACTTGG - Intronic
1156005879 18:32440268-32440290 ATAACTTGCTTAAGATCACACGG + Intronic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1156596378 18:38552410-38552432 GAGGCTTATTCAAGGTCACATGG - Intergenic
1156694535 18:39751022-39751044 GTGGCTTGTTTAACATAACATGG - Intergenic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157407672 18:47436969-47436991 GTGCCTTGTTCAAGTTCTCATGG + Intergenic
1157984356 18:52420368-52420390 CTGGTTAGATCAAGATCACATGG - Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1158606153 18:58898253-58898275 GTGTCTTGCTCAAGGACACGTGG - Intronic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160587754 18:79922088-79922110 GGGGCATGATCAAGAACACATGG - Intronic
1161240649 19:3221492-3221514 GTGGCTGGTGCAAGACCACACGG - Intergenic
1161438271 19:4277050-4277072 GTGGCTGATTCAAGGTCACAGGG + Intergenic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161850639 19:6736492-6736514 GGGACTTGTACAAGATCACATGG + Intronic
1161885101 19:6988482-6988504 GTGGCTGGCTCAAGGTCACATGG - Intergenic
1162073313 19:8168017-8168039 CTGGCTTGTCCAAGAGCACACGG + Intronic
1162461920 19:10818472-10818494 GTGGCTTGCCCGAGGGCACACGG + Intronic
1162738981 19:12763221-12763243 CTGGCTTCCTCCAGCTCACATGG - Exonic
1163168113 19:15511575-15511597 TTGGCTTCCTCAACATCAGAGGG - Intronic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1165404565 19:35621824-35621846 GTGTCGTGATCAAGGTCACAGGG + Intronic
1165463502 19:35958645-35958667 GTGACTTGCCCAAGTTCACTTGG + Intergenic
1165704531 19:37966345-37966367 GTGACTTGCTCATGATGGCAAGG + Intronic
1166326848 19:42056353-42056375 GTGGCTTGCTCCCCATCACTAGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1167117862 19:47498492-47498514 CTGACTTGCCCAGGATCACAGGG + Intronic
1167245066 19:48368203-48368225 ATAGCTTGCTCAGGGTCACACGG - Intronic
1167666479 19:50825417-50825439 GCCTCTTGTTCAAGATCACACGG + Intronic
1202713525 1_KI270714v1_random:30139-30161 GTGGCTTGGCCAAGATCCCACGG - Intergenic
925349620 2:3191706-3191728 GTGGACTGCTCAAGGACACAGGG + Intronic
925380311 2:3420259-3420281 GTGGCTTGCAGCAGGTCACACGG + Intronic
925603852 2:5638129-5638151 GTGGCTGGTTCAATATCACATGG - Intergenic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926383070 2:12310369-12310391 CTGACATGCACAAGATCACATGG - Intergenic
926806775 2:16718396-16718418 GGGGCTTGCCCAAGGACACACGG - Intergenic
926855157 2:17247969-17247991 GTAACTTGTTCAAGATCAAATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927102793 2:19800710-19800732 GTGGCTTGCCAGAGGTCACATGG - Intergenic
927469191 2:23359630-23359652 GTGGCTTGCTGAAGGTTTCATGG + Intergenic
927494814 2:23545307-23545329 GTGGCTTGCTCAAGGCCACTTGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928222653 2:29417575-29417597 ATGACTTGCCCGAGATCACATGG + Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929490048 2:42388020-42388042 GTGGCTTGCCCAATGTCACATGG - Intronic
929557946 2:42937156-42937178 GGGGCTTGCTTAAGGTCACCCGG + Intergenic
929874699 2:45786845-45786867 GTAACTTGCACAAAATCACATGG + Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
930737846 2:54797793-54797815 GTAACTTGCCCAAGATTACATGG - Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
931919380 2:66996607-66996629 GTGACATGGCCAAGATCACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
933509951 2:83227864-83227886 GAGGCGTGCTCAGTATCACAGGG - Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
934615349 2:95767298-95767320 GCGCCTTGTTCAAGATCATAGGG + Intergenic
934645556 2:96057261-96057283 GTGCCTTGTTCAAGATCATAGGG - Intergenic
934838960 2:97613350-97613372 GCGCCTTGTTCAAGATCATAGGG - Intergenic
935177362 2:100661620-100661642 GGGGCTTCCACAGGATCACATGG + Intergenic
935644804 2:105325398-105325420 GTGGCTTGCTCAAGGTTACCTGG + Intronic
935870776 2:107446701-107446723 CTGGCATGTGCAAGATCACAGGG + Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936264126 2:110987543-110987565 GTACCTTGCTCAAGGTTACATGG + Intronic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
936913790 2:117618665-117618687 GTGACTGGCTTAAGGTCACATGG - Intergenic
937068303 2:119037567-119037589 TTGGCTCACACAAGATCACAAGG - Intergenic
937329407 2:121016496-121016518 TTGGCTTGCCCAAGTTCCCATGG + Intergenic
937358726 2:121214316-121214338 GTAGCCTGCTCAAAATCATACGG + Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938626883 2:133119795-133119817 GTAACTTGCTTATGATCACATGG - Intronic
938707144 2:133942205-133942227 GTAGCTTTCTTATGATCACAGGG - Intergenic
938756117 2:134380524-134380546 GTGGCTTGCCCAAGACTGCAAGG - Intronic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939002361 2:136751079-136751101 GTATCTTGTTCAAGGTCACAAGG + Intergenic
939402505 2:141712475-141712497 GTGGCTTGCTCAGGATCCCACGG - Intronic
939763310 2:146212019-146212041 GTATCTTGCTCAAGGTCATATGG + Intergenic
940354344 2:152722125-152722147 ATGGCTTGCTCAATATCAAAAGG + Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941681322 2:168402473-168402495 GTGGCTAACTCAAGATCTGATGG + Intergenic
941977386 2:171420230-171420252 GCGGCTTGGTCAAGATCTCAGGG + Intronic
942368288 2:175253460-175253482 GTAGCTTGCTTCAGGTCACAGGG + Intergenic
942605659 2:177687862-177687884 GTGACTTGTTCAAGGTCCCAGGG + Intronic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
943415044 2:187591231-187591253 GTGGCTTTTGCAAGCTCACAGGG + Intergenic
944016266 2:195043062-195043084 GTGAGTTGCTCAAAGTCACATGG - Intergenic
944056899 2:195531741-195531763 GTTGCTTGCTCAGGATCACATGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945343782 2:208688399-208688421 GAGGCTTGCCAAAGATCAGATGG + Intronic
945444242 2:209916996-209917018 GAGGCTTGCACAAGATCTCATGG + Intronic
945503459 2:210607673-210607695 GTGATGTGCTCAAAATCACACGG - Intronic
945644073 2:212467530-212467552 CTGGCGGGCTCAACATCACATGG - Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947186551 2:227460406-227460428 GTTGCTTGCTCAAGCTCCCAGGG - Intergenic
947186701 2:227461860-227461882 GTTGCTTGCTCAAGCTCCCAGGG + Intergenic
948704038 2:239778402-239778424 ATGGCTTGCCCCAGATCACCGGG - Intronic
1168762954 20:362231-362253 GTGGCTTGCCCAAAGTCAAATGG + Intergenic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1168961727 20:1874630-1874652 GTGACTTGCCCAGCATCACATGG - Intergenic
1169250839 20:4060212-4060234 GTCACTTGCTCAAGGCCACATGG - Intergenic
1169788001 20:9381280-9381302 GTTCCTAGCTCAAGGTCACAGGG - Intronic
1170366072 20:15599531-15599553 GTGGCTTGTCCAAGACCACACGG - Intronic
1170427004 20:16245150-16245172 ATGACTTGCTGAAGGTCACAAGG + Intergenic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172114601 20:32566223-32566245 GTGATTTGCCTAAGATCACATGG + Intronic
1172193919 20:33079209-33079231 GTGGCTGGCCCAAGGTCATACGG + Intergenic
1172230297 20:33331755-33331777 GTGGCCTGCACAAGAGCATAAGG - Intergenic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172504072 20:35448316-35448338 GAGGGTTGCTCAAGAACATAAGG + Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172648951 20:36489693-36489715 GAGGCTGGCTCCAGATCACGGGG + Intronic
1172801180 20:37577297-37577319 GTGACTTGCGCAGGGTCACAAGG - Intergenic
1172822866 20:37753843-37753865 GGAGCTTGCACAAGATTACATGG + Intronic
1172822881 20:37753973-37753995 GGGGCTTGCACAAGATTACATGG + Intronic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173480563 20:43395619-43395641 GTGCCTTGCTCAAGGTTTCAAGG - Intergenic
1173601438 20:44298304-44298326 TTGACTTGGTCAAGAACACACGG + Intergenic
1173695446 20:45007206-45007228 GTTGCTTGTTCATGGTCACATGG + Intronic
1173759409 20:45546621-45546643 GTAACTTGCCCAAGATTACAGGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1173858576 20:46267498-46267520 GTGGCTTGCTGAGAACCACATGG + Intronic
1174087448 20:48019276-48019298 GTGACTTGCTCCACATCCCAAGG + Intergenic
1174128838 20:48327694-48327716 GTGACTTGCTCCACATCCCAAGG - Intergenic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174304803 20:49607564-49607586 GTGACTTGCCTAAAATCACAGGG - Intergenic
1174324065 20:49765012-49765034 GTAATTTGCTCAGGATCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175249248 20:57598868-57598890 GTGGCTTGCCCAAAGCCACATGG - Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176379187 21:6103325-6103347 GTGGCCTGCTCAGGAACGCAGGG + Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1177650509 21:23954986-23955008 ATAACTTGCTCAAAATCACATGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178851364 21:36215219-36215241 GTGGCTTGCCCAGGATCCCAAGG - Intronic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179182826 21:39060294-39060316 GTTGTCTGCTGAAGATCACAAGG + Intergenic
1179228821 21:39481465-39481487 GTAGATTGCTCCAGGTCACAAGG + Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179450176 21:41463230-41463252 CTGGCAGGCTCAACATCACATGG - Intergenic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179744286 21:43434912-43434934 GTGGCCTGCTCAGGAACGCAGGG - Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181489798 22:23254482-23254504 GTGGCTTCCCCAAGGTCTCATGG + Intronic
1181776285 22:25162040-25162062 CTGGCATGCCCAAGGTCACATGG - Intronic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1181890234 22:26056392-26056414 ATGGCCTGCTCAAGGTCAAACGG + Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182014256 22:27025839-27025861 GTGGATTGCCCAAAGTCACACGG - Intergenic
1182032018 22:27166833-27166855 GTGTCTTGCTTAAGATCCAAAGG - Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183215814 22:36479234-36479256 GTGGCCTGCCCAAGGCCACAGGG + Intronic
1183250552 22:36727141-36727163 TTGGCTTTCCCAAGGTCACATGG + Intergenic
1183344508 22:37299797-37299819 ATGGCTTGCTTAAGGTCACACGG - Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1183748497 22:39705800-39705822 ATGCCTTGCTCAAGGCCACACGG + Intergenic
1183769088 22:39908040-39908062 GTGACTTGTTTAAGATCACGTGG - Intronic
1184108523 22:42382400-42382422 GTGACTTGCCCAAGTCCACAAGG + Exonic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184475193 22:44716640-44716662 GTGGGTTGCTTGAGGTCACAGGG + Intronic
1184558486 22:45247120-45247142 GAGTCATGCTCAAAATCACACGG + Intergenic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
1184797202 22:46739119-46739141 GTCACTTGCCCAAGAGCACAGGG + Intergenic
1185124393 22:48998881-48998903 TTTGCTTGCTCCAAATCACAGGG + Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949805210 3:7947582-7947604 GTTACTTGCCCAAGATCAAATGG + Intergenic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950028373 3:9835649-9835671 ATGGCTTACCCAAGATCACGTGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950197562 3:11019905-11019927 GTCTCTTGCCCAAGGTCACATGG + Intronic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950367681 3:12499625-12499647 GTAGCTTGCCCAAGATTACGTGG + Intronic
950440768 3:13008960-13008982 GTGACTTGCACAAGGCCACATGG + Intronic
950473115 3:13198688-13198710 GTGCCTTGCCCATGGTCACATGG - Intergenic
950534017 3:13569181-13569203 GTGGCTTGTGCAAGATGAGAGGG + Intronic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
950585632 3:13890410-13890432 GTCACTTGCACAAGGTCACAGGG - Intergenic
950683461 3:14601284-14601306 GAGGCTTGTCCAAGATCACAGGG + Intergenic
950839869 3:15957618-15957640 GTAGCTTTCCCAAGGTCACATGG + Intergenic
950897908 3:16469974-16469996 GTGACTTGCTCAAGGTCATGGGG + Intronic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
952358558 3:32606818-32606840 ATGACTTGCCCAAGACCACAAGG - Intergenic
952743964 3:36760940-36760962 GTATCTCGCTCAGGATCACATGG + Intergenic
952744339 3:36763658-36763680 GTGCCTTGCCCAGGGTCACACGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
954042177 3:47896995-47897017 GTGGTTTGCCCATGATCACATGG + Intronic
955148901 3:56347472-56347494 GTGGCTGGGTCACGCTCACAGGG - Intronic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955697325 3:61649802-61649824 GTTACTTGCTCAAGATCATGTGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
955981699 3:64533811-64533833 TTGGCCTGCTCAAGACCACCTGG + Intronic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956573288 3:70721273-70721295 GTAGACTGCTTAAGATCACATGG + Intergenic
956615968 3:71172991-71173013 GTGACTTGCTTCAAATCACAGGG + Intronic
956635331 3:71358614-71358636 ATGGTTTGCTCAAGGTCAGACGG + Intronic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959206399 3:103312354-103312376 ATAACTTGCCCAAGATCACAAGG - Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960536237 3:118817416-118817438 GTGGCTTGCCCATGGTCACACGG + Intergenic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960701289 3:120441883-120441905 GTAGTTTTCCCAAGATCACATGG + Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961122736 3:124386567-124386589 GTGACTTGCACAAGCTCATATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
962059209 3:131907290-131907312 ATGGCTTCCTCAACCTCACATGG + Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963313715 3:143735843-143735865 GTAGCTTGCTCAATGTCACATGG - Intronic
963594776 3:147312138-147312160 CTTGCTTTCTCAAGATCCCAGGG - Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
965862755 3:173166964-173166986 GTGGCCTGAACAAGACCACATGG - Intergenic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966112686 3:176421865-176421887 GTAGCTTGGTAAAAATCACAGGG + Intergenic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
966338511 3:178898813-178898835 ATGAATTGCTCAAGATTACATGG - Intergenic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967290734 3:187917368-187917390 GTGCCTTGCACAAGGTCACTTGG - Intergenic
967674806 3:192284270-192284292 GTGACATGCTGATGATCACAGGG + Intronic
967830557 3:193915845-193915867 TTGACTTGTTCAAGGTCACATGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
968884523 4:3320504-3320526 GTGACTTGCTCACAGTCACAGGG + Intronic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969119998 4:4901088-4901110 GTGGCTGGCCCAAGGACACAGGG - Intergenic
969233535 4:5849073-5849095 GTTCCTTGCCCAAGGTCACATGG + Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969427686 4:7135303-7135325 GGGACTTGTTCAAGCTCACATGG - Intergenic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969974393 4:11083208-11083230 TTGACTCGCTCAAGAGCACATGG + Intergenic
969993068 4:11283966-11283988 CTGGCAGGCTCAACATCACATGG + Intergenic
970006095 4:11412250-11412272 GTGTCTTGCTGACCATCACATGG - Intronic
970526794 4:16940741-16940763 GTGGCTTTCAAAAAATCACATGG + Intergenic
970693152 4:18643086-18643108 GTGTCTCTCTCAAGGTCACATGG - Intergenic
970828588 4:20307818-20307840 GTAACTTGCCCAAGCTCACATGG + Intronic
970912858 4:21298017-21298039 ATAACTTGCTTAAGATCACAAGG - Intronic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971820271 4:31544191-31544213 GTGGCATGATCACAATCACAAGG - Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972736672 4:41848750-41848772 GAGGCTTGGTCAAGGTCACATGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973797476 4:54442866-54442888 GTAGCTTGCCCAAAGTCACACGG - Intergenic
973809115 4:54552955-54552977 GTGGTTTGCCCAAGGTCGCATGG - Intergenic
974145109 4:57937185-57937207 CTGGCTGGCTCAACACCACATGG - Intergenic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
975038944 4:69720802-69720824 GTGACTTGCTCAAGTTTTCAGGG + Intergenic
975326830 4:73068326-73068348 GTTACTTGCACAGGATCACATGG - Intronic
975423946 4:74204183-74204205 ATGACTTGCCCGAGATCACAGGG - Intronic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
975765383 4:77662201-77662223 GTGGCTGGCCCAAGGTCACTTGG - Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976597574 4:86908400-86908422 CTTGCTTGCTTAAGATCCCAGGG - Intronic
978377744 4:108093621-108093643 GTGACTTGTTTAAGCTCACAAGG + Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
979293005 4:118998985-118999007 ATGGCTTGCCCAAGATCACACGG - Intronic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
979709975 4:123767934-123767956 GTTACTTGCTCAGGATTACACGG + Intergenic
979899235 4:126197008-126197030 GTGACTTGTTGAAGATCAGATGG + Intergenic
980852580 4:138400970-138400992 ATGGCTTCATCAAGATCACGTGG - Intergenic
980895832 4:138859189-138859211 GTGATTTGCCCAAGATCAGACGG + Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
981648341 4:147025956-147025978 GTGCCTTCCTTAAGGTCACATGG - Intergenic
982168212 4:152635404-152635426 GTGGCTTGTTCAAGTTCACATGG - Intronic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
982986662 4:162217317-162217339 GGGGAGCGCTCAAGATCACAAGG + Intergenic
983236710 4:165188153-165188175 CTGGCAGGCTCAATATCACATGG + Intronic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
984622352 4:181967900-181967922 GTGCCTTGCTTGAGATCACAGGG + Intergenic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
986212503 5:5687369-5687391 GTGTCTTGCTCAGGTTTACAGGG - Intergenic
986265771 5:6189217-6189239 GTGACTTGCCCAAGATCCTAAGG + Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
990007127 5:50956632-50956654 GTAACTTGCACAAGATTACAGGG + Intergenic
990170131 5:53038716-53038738 GTGACTTGCTCATGTTCCCATGG - Intronic
990382346 5:55230024-55230046 GTGACTTGCTTAAGGTCACCTGG + Intergenic
990692904 5:58383693-58383715 GTGACTTGCCTAAGTTCACATGG + Intergenic
991206541 5:64056231-64056253 GTAACTTGTCCAAGATCACACGG - Intergenic
992117608 5:73555920-73555942 GTGTCTTGCCCAGGGTCACATGG - Intronic
992182722 5:74213807-74213829 GTAGCTTGTCCAAGGTCACATGG + Intergenic
992937851 5:81728516-81728538 GTGGCTTGCACAAGGTTATATGG - Intronic
993109224 5:83634997-83635019 ATGACTTGCCCAAGCTCACATGG - Intergenic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993524942 5:88953760-88953782 GTGAGTTGCACAGGATCACAAGG - Intergenic
994657505 5:102611892-102611914 GTTGCTTGATCAGAATCACATGG - Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
995247074 5:109946496-109946518 GTGACTTGTCCACGATCACATGG + Intergenic
996032738 5:118724069-118724091 GTGGCTTGCCCAAGATCACTTGG - Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997650277 5:135512258-135512280 GTGGCTCACCCAAGGTCACAAGG - Intergenic
997690242 5:135823245-135823267 GGGGCTTGCTCAGGATCAAAGGG + Intergenic
997747581 5:136312569-136312591 ATGACTTGCCCAAGACCACAGGG + Intronic
998164206 5:139833269-139833291 GTGACATGCCCACGATCACAAGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999117282 5:149175018-149175040 GGGGCTTTGTAAAGATCACAAGG + Intronic
999238075 5:150111717-150111739 GTGACTTGCCCAAGATCATCTGG - Intronic
999267217 5:150274717-150274739 GTAGATTGCCCAAGGTCACATGG + Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
999681817 5:154067772-154067794 GGGGCTTGTCCAAGGTCACATGG - Intronic
999729438 5:154465334-154465356 GTGGCTTGCCCAAGGTCACCAGG + Intergenic
1000020450 5:157314185-157314207 GTGCCTTGCTGAAGGCCACATGG - Intronic
1000247809 5:159463441-159463463 GTGACTTGCACAAGGTCATATGG + Intergenic
1000815008 5:165909843-165909865 GTGGTTTGTTCAAGAACACTAGG + Intergenic
1001019680 5:168172502-168172524 GTGGCTTGTCCAAGCTCCCACGG + Intronic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001125886 5:169018908-169018930 GTGGCTGTCTCAAGGTCACTCGG + Intronic
1001181966 5:169528859-169528881 GTGGCCTGCTCATGATCTCTGGG + Intergenic
1001405769 5:171476238-171476260 CAGGCTTGCCCAAGGTCACATGG + Intergenic
1001594234 5:172887521-172887543 GTCGTTTGCTGAAGGTCACATGG + Intronic
1001650528 5:173312655-173312677 GTGGCATGCTAAAGAGGACAGGG - Intergenic
1001694680 5:173661128-173661150 GCGACTTGCTCAAGATCATGTGG + Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002069293 5:176669909-176669931 GTGGCCTGCTGAATATCACATGG + Intergenic
1002099344 5:176849728-176849750 GTGGCTTGCCCAAGGCCACGTGG + Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1002372495 5:178766643-178766665 GGAGCTTGCCCAAGGTCACATGG - Intergenic
1002933312 6:1650020-1650042 GTTGCTTGCCCAAGGTCAGACGG - Intronic
1003044066 6:2716731-2716753 ATAGCTTGTCCAAGATCACATGG - Intronic
1003337238 6:5185652-5185674 GTGGCTTGCTCAGGGTCAGCTGG + Intronic
1003829532 6:9992642-9992664 ATGGCTTGGCCAAGACCACAGGG - Intronic
1003916681 6:10793351-10793373 GTAGCCTGCCCAAGATCTCACGG + Intronic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1004942270 6:20571211-20571233 ATGGCTTGACTAAGATCACAAGG - Intronic
1005396892 6:25391783-25391805 GTGGATTGTCCAAGGTCACATGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1006803704 6:36775356-36775378 AGAGCTTGCTCAAGGTCACACGG - Intronic
1006905751 6:37532289-37532311 ATGCCTTGCCCAAGACCACATGG - Intergenic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1007965692 6:46001759-46001781 GTGTTTTGCTCAAGGTCCCATGG - Intronic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008136237 6:47780402-47780424 ATGATTTGCTCAAGATCAGAGGG + Intergenic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008405889 6:51118049-51118071 GTGGTTTGCCTAGGATCACATGG + Intergenic
1008433183 6:51445020-51445042 GTGGCTTTCTCAAGTTCCCTGGG + Intergenic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1009471892 6:64036842-64036864 GTAACTTGCTCTAGACCACACGG + Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010300051 6:74249509-74249531 GGGACTGGCTCAAGTTCACATGG - Intergenic
1011082828 6:83508315-83508337 GTGGCTTGGCCCAAATCACATGG + Intergenic
1011504289 6:88023943-88023965 ATGACTTGCTCAGGGTCACATGG + Intergenic
1011514440 6:88137188-88137210 GTATCTTGCCCAAGTTCACATGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1012081978 6:94770613-94770635 ATGGCTTGATCAACATCACATGG + Intergenic
1012223445 6:96678661-96678683 GTGGTCTGCTCAAGGCCACATGG + Intergenic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1013157879 6:107511116-107511138 ATGGCTTTTTCAAGGTCACATGG + Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1013581329 6:111537351-111537373 GTAACTTGCCTAAGATCACATGG + Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1017223538 6:151993780-151993802 GTGTCTTGCCCAAGGCCACACGG + Intronic
1017447078 6:154516869-154516891 CTGACTTGCTCAAGGTTACAGGG - Intergenic
1017587538 6:155943822-155943844 GTCACTTGCTCAAAGTCACATGG - Intergenic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018042996 6:159941459-159941481 GTGGGTGGCTCAAGGACACAGGG + Intergenic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1018607256 6:165610868-165610890 GCTGCTTGCTAAAGGTCACATGG - Intronic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1018771668 6:166976294-166976316 GTGGCTTGCTCCAGAACCCAAGG - Intergenic
1019575392 7:1735295-1735317 GTGGATGGCCCAAGGTCACATGG + Intronic
1019729769 7:2623457-2623479 GTGTCTTGCTCAAGGTCCCCCGG - Intergenic
1019792798 7:3028116-3028138 ATGGTTTGCCCAAGGTCACATGG + Intronic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021082088 7:16376721-16376743 GTGTCTTGCTCTAATTCACAAGG + Intronic
1021299894 7:18959613-18959635 GTGGCTTGCTCATTGTCACATGG - Intronic
1021612030 7:22466873-22466895 GTAACTTGGTCAAGATCTCATGG - Intronic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022303557 7:29125303-29125325 CTGACTTGATCAAGATGACAAGG + Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1024231409 7:47366725-47366747 GTGGCCTGCCCAGGTTCACATGG - Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027352735 7:77328056-77328078 GTGACTTGCCCAGGAGCACATGG + Intronic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028921187 7:96312204-96312226 ATAACTTGCCCAAGATCACATGG - Intronic
1030271477 7:107673408-107673430 GTACCTTGATCAATATCACAGGG - Intronic
1030796090 7:113789831-113789853 GTGAGTTTGTCAAGATCACATGG - Intergenic
1031526676 7:122830097-122830119 CTGGCTTGCCCAAGGTGACACGG + Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1032087026 7:128889852-128889874 GTAACTTGCCCAAGACCACACGG + Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1033662888 7:143414870-143414892 GTGATTTGCCCAAGATCACTTGG - Intergenic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034105953 7:148490015-148490037 GTATATTGCTCAAGGTCACACGG - Intergenic
1034319344 7:150165180-150165202 GTGACTTGCTTGAGATCAGATGG - Intergenic
1034500801 7:151449212-151449234 GTAGCTTGCACAAGGTCACAGGG + Intergenic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034731145 7:153388570-153388592 GTAACTTGCCCAATATCACATGG + Intergenic
1035784667 8:2251192-2251214 GTGTCGTCTTCAAGATCACAGGG + Intergenic
1035808140 8:2470521-2470543 GTGTCGTCTTCAAGATCACAGGG - Intergenic
1035847446 8:2880591-2880613 GTGTCTTGCTCAGGAGCAAAAGG + Intergenic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1036757949 8:11483791-11483813 GTGACTTGTCCAAAATCACAAGG - Intergenic
1036770930 8:11577998-11578020 GTGAATTGCTCCAGGTCACAAGG + Intergenic
1037074642 8:14699325-14699347 TTGACTTGCTGAAGATCATATGG - Intronic
1037167172 8:15845260-15845282 GTGCCTTGCGCAGGGTCACATGG - Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037603269 8:20416910-20416932 GTGGGTTGCTCCAGGACACATGG + Intergenic
1037648015 8:20811311-20811333 GAGCCTTGCTCAACATCAAATGG - Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038240343 8:25802342-25802364 GTGACTTGCTTAAGGTCAAATGG + Intergenic
1039539611 8:38353105-38353127 ATGACTTGCTCAAGTGCACATGG + Intronic
1041099136 8:54379120-54379142 GTGGCTCGCCCAAGTCCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041414282 8:57590168-57590190 GTGACTTGCTCAAAGTAACATGG - Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1042627559 8:70775623-70775645 GTGGTTTTCTCAAGAATACAAGG - Intronic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1043265494 8:78262554-78262576 ATGGCTTGTACAAGACCACAAGG - Intergenic
1043561339 8:81497538-81497560 ATGGCTTGTTCAAAGTCACATGG + Intergenic
1043880828 8:85540441-85540463 GTAACTTGTTCAAGATCCCATGG - Intergenic
1043884843 8:85587319-85587341 GTGGCTTGCCAAAACTCACACGG + Intergenic
1044794556 8:95883853-95883875 GTAACTTGCTCAAAATCAAATGG + Intergenic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045704517 8:104905850-104905872 TTGCCTATCTCAAGATCACATGG + Intronic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1045757061 8:105556511-105556533 GTAACTTGCTAAGGATCACATGG + Intronic
1045769411 8:105717892-105717914 GTAGCTTGCTCATCATCTCATGG + Intronic
1046603219 8:116341539-116341561 GTGGCTTGCCCAAGTTCACTGGG - Intergenic
1047514091 8:125538404-125538426 GTGGCTTGCACAAGGCCACGTGG - Intergenic
1047657199 8:126991003-126991025 ATAACTTGGTCAAGATCACATGG - Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048170747 8:132103913-132103935 GTGGATTTATTAAGATCACAAGG + Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048844579 8:138594529-138594551 GTAGCTTGCTCAAGGCCACCTGG - Intronic
1049017383 8:139930413-139930435 GTGGGTGGCTCAGGATCACAGGG + Intronic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1050086152 9:1967847-1967869 TTGACTAGCCCAAGATCACAGGG - Intergenic
1050337425 9:4602807-4602829 GTCCCTTGCTCAAGGTGACATGG - Intronic
1050780888 9:9333659-9333681 GTGGCACGTTCAAGATTACATGG - Intronic
1050870228 9:10558539-10558561 GTAGCTTGCCCAAGGCCACATGG - Intronic
1050905092 9:10993828-10993850 GTTGCAGGCTCAATATCACATGG - Intergenic
1051147773 9:14047153-14047175 ATGACTTGCCCAATATCACATGG + Intergenic
1051380378 9:16451966-16451988 GTATCTTGCTCAAGATCAGGAGG + Intronic
1051441111 9:17084162-17084184 GTGACTTGCCCAATATCATATGG - Intergenic
1052027377 9:23588617-23588639 GTGACTTGCTTAAGATAAAATGG + Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1052974172 9:34399749-34399771 GTGGCTTGTTGAAGATCACAGGG + Exonic
1053173114 9:35904955-35904977 GGGGTTTGCCCAACATCACAGGG + Intergenic
1053266264 9:36716040-36716062 GTGGGTTGCCCAAGGTCACCTGG - Intergenic
1053293031 9:36894561-36894583 ATGACTTGCTGGAGATCACATGG - Intronic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054869521 9:70036380-70036402 GTGACTTGCTCAAAAGTACAGGG - Intergenic
1054959817 9:70955585-70955607 GTGGTTTATTCAAGGTCACATGG + Intronic
1055424339 9:76178440-76178462 GTGGCTTGCCCAGTATCACATGG - Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056140167 9:83669913-83669935 ATAACTTGCCCAAGATCACATGG - Intronic
1056236060 9:84595860-84595882 TGGACTTGCTCAAGATAACATGG - Intergenic
1056277633 9:85008651-85008673 ATGTCTTGCCCAAAATCACATGG + Intronic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1057329520 9:94100192-94100214 GTGACTTGCTCAGGGTCACGTGG + Intronic
1057695136 9:97317788-97317810 AGGGCTTGGTCAAGGTCACATGG - Intronic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058644999 9:107123206-107123228 GTAAATTGCTCAAGAGCACACGG - Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1059038501 9:110786866-110786888 GTGTCTTGCCCAAGAGCACCAGG - Intronic
1059281281 9:113136129-113136151 ATGGCTGGCCCAAGGTCACAAGG - Intergenic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059526460 9:114995599-114995621 GTGGCCTTCTCAAGGCCACAAGG + Intergenic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059730982 9:117056662-117056684 GTGCCTTGGTAAAGATAACAAGG - Intronic
1059754090 9:117276271-117276293 GTAGCTAGCCCAAGATCACACGG + Intronic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1059976535 9:119723937-119723959 TTGACTTGCTCAGGATCTCATGG - Intergenic
1060000232 9:119952118-119952140 GTAACTTGCACAAGCTCACATGG + Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060212609 9:121719769-121719791 GTGGCTTGACCAAGGTCTCATGG + Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060748992 9:126156372-126156394 ATCGCTTGCTCAAGGTCACAGGG + Intergenic
1060826277 9:126689805-126689827 GTTGCTTGCTCAGGGTCGCATGG - Intronic
1060880604 9:127115545-127115567 GTCGCTTGTTCAAGATCACTTGG + Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061291094 9:129650739-129650761 GTGACTAGCCCAAGATGACAAGG + Intergenic
1061480288 9:130894681-130894703 GTGACTTGCCCCAGATCTCATGG + Intergenic
1061498703 9:130990252-130990274 GTGGCTGGCCCAAGAGCACGGGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1061818237 9:133208594-133208616 TTGGCCTGCTCCAGATCACAGGG - Exonic
1062242219 9:135546764-135546786 TTGGCCTGCTCCAGATCACAGGG + Exonic
1062378850 9:136277132-136277154 GTGATTTGTTCAAGGTCACATGG - Intergenic
1062456639 9:136642832-136642854 GTGGCTGGCTCAGGACCAAAGGG + Intergenic
1186980779 X:14955309-14955331 CTGGCAGGCTCAACATCACATGG + Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187206624 X:17187649-17187671 GTGGCTAGTCCAAGGTCACATGG + Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1187479692 X:19643898-19643920 ATGACTTGCCCAAGTTCACATGG + Intronic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188907964 X:35810785-35810807 GTGGCTTCCTTAAGATCTCAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189220893 X:39370731-39370753 GAGGCTTTCCCAAGATCACTTGG - Intergenic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189663852 X:43332178-43332200 GTGACTTTCTTAAGATCTCATGG - Intergenic
1190055186 X:47177358-47177380 GTGCCTTGCTCCTGATCACAGGG + Intronic
1190444985 X:50515116-50515138 GTGGCTCCCCCAAGAGCACATGG + Intergenic
1190638873 X:52463751-52463773 GTATCTTGCCCAACATCACAAGG - Intergenic
1190775612 X:53550101-53550123 GTGACTTGCCCTACATCACACGG + Intronic
1190902860 X:54695704-54695726 GTTCCTTGCTCAAGGTCCCAAGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192240083 X:69321693-69321715 GTGGCATGCCCAAAGTCACATGG - Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193246054 X:79231678-79231700 GTGTCTTATTCAAGACCACAAGG - Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195402903 X:104480792-104480814 GTCTCTTGCTCAAGTTCGCATGG + Intergenic
1195671394 X:107473147-107473169 GTGACTTGCTCAGGGGCACATGG + Intergenic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1196084512 X:111670530-111670552 GCTGTTTGCTCGAGATCACATGG - Intronic
1196579391 X:117361496-117361518 CTGGCAGGCTCAACATCACATGG - Intergenic
1196699283 X:118650133-118650155 GTGACTTGCTTAGGGTCACAGGG - Intronic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1197752919 X:129977924-129977946 GTGGCTTGCTCAAGATTGCATGG - Intergenic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1198228620 X:134669339-134669361 GTAACTTGCCCAACATCACACGG - Intronic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198695601 X:139333696-139333718 ATGGCTCTCTCAAGGTCACATGG + Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199200288 X:145079527-145079549 GTGCTTTGTTCAAGGTCACATGG - Intergenic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199438948 X:147846338-147846360 ATGACTTGATCAAGCTCACATGG - Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199531745 X:148855757-148855779 GTAACTTGACCAAGATCACATGG - Intronic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199732421 X:150649188-150649210 GTGCCTTGTCCCAGATCACATGG + Intronic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1200405185 Y:2803040-2803062 CAGGTTTGCTGAAGATCACATGG + Intergenic
1201774492 Y:17648491-17648513 GTGCCTTGGGCAAGCTCACAAGG - Intergenic
1201827064 Y:18257498-18257520 GTGCCTTGGGCAAGCTCACAAGG + Intergenic