ID: 928084345

View in Genome Browser
Species Human (GRCh38)
Location 2:28336511-28336533
Sequence CTGTGTGACCCCAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928084340_928084345 -3 Left 928084340 2:28336491-28336513 CCAGGAGTTCCCACCTTGCTCTG 0: 1
1: 0
2: 0
3: 28
4: 280
Right 928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG 0: 1
1: 0
2: 1
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928084345 Original CRISPR CTGTGTGACCCCAAGGATGA TGG Intronic
900928715 1:5722211-5722233 CTGTCTGAACCCCCGGATGAAGG + Intergenic
902829293 1:18999801-18999823 CTTTGGGAGGCCAAGGATGAAGG + Intergenic
906868239 1:49446960-49446982 CTGTCTGTGCCCAGGGATGAAGG - Intronic
907403035 1:54237256-54237278 GTGTGTGAACCAAAGGACGAGGG - Intronic
908243487 1:62208415-62208437 CTGTGTGACCCCAAGGCTTTGGG - Intronic
908382658 1:63611449-63611471 CTGTGTGACCTCAGGGGTTAAGG - Intronic
909645012 1:77907228-77907250 CTGTGTTAACACAAGGATAAAGG - Intronic
911275364 1:95853013-95853035 CTGTGTGACCCCAGTGCTCAGGG - Intergenic
913247377 1:116881908-116881930 TTGTGTGACCCTGAGAATGAGGG + Intergenic
914716587 1:150259357-150259379 CTGTCTGACGCAAAGGCTGAGGG - Intronic
914817806 1:151075884-151075906 CTTTGTAACCCCTAGGATTAAGG - Intronic
916077013 1:161207070-161207092 CTGTATAACCCAAATGATGAAGG + Intronic
921086293 1:211796436-211796458 CTGAGGGACACCAAGGATGGTGG + Intronic
921092558 1:211857512-211857534 CTGTTTTACCCCAAGGATTCAGG - Intergenic
921448891 1:215279350-215279372 CCATGTTCCCCCAAGGATGAAGG - Intergenic
922334509 1:224607834-224607856 CTGGGTCACACAAAGGATGAAGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064449012 10:15425151-15425173 CAGTGTGTCTCCAAGGCTGAGGG - Intergenic
1065731869 10:28716908-28716930 CTGTGTCACCCCATGGAGGAAGG - Intergenic
1068633409 10:59321827-59321849 ATGTGTGACCCCAAGGAGTAAGG + Intronic
1068685108 10:59862241-59862263 CTGTGTGACCCCGAGGCAGGTGG + Intronic
1068901213 10:62270831-62270853 CTGTAAGAGCCCAGGGATGATGG - Intergenic
1069996224 10:72343652-72343674 CTGTGTGACACCAGGGACAAGGG + Intronic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070939806 10:80334583-80334605 CTGTGTCATCCCATGGCTGAAGG + Intergenic
1071334382 10:84589261-84589283 CTCTGAGACACCAGGGATGAGGG - Intergenic
1071992393 10:91112649-91112671 CTGTGTGATCCCACGGCAGAAGG + Intergenic
1072460700 10:95616208-95616230 CCTTGTGACCCAAAGAATGAAGG + Intronic
1076070147 10:127482622-127482644 CTGTGGAAGCCCAAGGGTGAGGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078269462 11:9781437-9781459 CTGTCTGTCTCCAAGAATGATGG - Intronic
1079349990 11:19684398-19684420 CTCTGAGACCCCAGTGATGAAGG + Intronic
1080139421 11:28898246-28898268 CTGTGTCACCCCTAGGTTTAGGG + Intergenic
1082706678 11:56501027-56501049 CAATGTGACCCCAAAGATGCTGG - Intergenic
1082707714 11:56512926-56512948 CAATGTGACTCCAAGGATGCTGG - Intergenic
1082708120 11:56518699-56518721 CTGTGTCAGCCCATGGAGGAAGG + Intergenic
1083742978 11:64720947-64720969 CTGTGTGCATCCAAGGGTGAGGG + Intronic
1085479145 11:76807243-76807265 CTGAGTGACTCAAAGGATTAGGG + Intergenic
1085767486 11:79295711-79295733 TTGTCTGACCCCAAAGAAGAGGG + Intronic
1085870308 11:80341658-80341680 CTGTGTGAGCCCCAAGATGGTGG - Intergenic
1087813926 11:102637809-102637831 CAATGTCACGCCAAGGATGATGG - Intergenic
1088352284 11:108903439-108903461 CTGTTTGAATCCATGGATGAGGG - Intronic
1088470787 11:110186065-110186087 CTGTGTAAGCCCAAAGCTGATGG - Intronic
1089806815 11:121097889-121097911 CTGTGTGAAGCCAGGGATGTTGG - Intergenic
1090168821 11:124580330-124580352 TTGTGTGCCCCCAAGTATGCAGG - Intergenic
1097112980 12:56675981-56676003 CTTTGTGAGGCCAAGGCTGATGG + Intronic
1100232548 12:92623021-92623043 CTGTGTCACCCCATGGCAGAAGG - Intergenic
1101777385 12:107806771-107806793 CTGTGGGACCCCGAGAATTATGG + Intergenic
1102366685 12:112343236-112343258 CTGTGGGACATCAAGGATGCAGG - Intronic
1102992726 12:117326754-117326776 CTTTGTTTCCCCAAGGAAGAGGG - Intronic
1104774830 12:131384912-131384934 CTGTGGGAGCCCAGGGATGCTGG + Intergenic
1104887970 12:132122615-132122637 CTGTGTGGCCCTAAGGATTTTGG + Intronic
1104967602 12:132515654-132515676 CTTTGGGACCCCAAGGAGGGTGG + Intronic
1105376429 13:19849365-19849387 CTTTGTGAGGCCAAGGAAGAAGG - Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1105530012 13:21210783-21210805 CTGTGTCATCCCATGGTTGAAGG + Intergenic
1107981300 13:45736720-45736742 CTGGGTGGCCCCAAGGCTGGAGG + Intergenic
1111959054 13:94789716-94789738 CTTTGGGACGCCAAGGCTGATGG + Intergenic
1111979133 13:94998663-94998685 CTTTGAGAGGCCAAGGATGAAGG + Intergenic
1113256336 13:108510358-108510380 CTTTGGGACGCCAAGGAGGATGG - Intergenic
1113877819 13:113605751-113605773 TTCTGTGACCCCCAGGAGGATGG - Intronic
1114079665 14:19192784-19192806 TTATGTGACCCCAAGGGAGAGGG + Intergenic
1114390770 14:22305772-22305794 CTGCTTGACTCAAAGGATGATGG - Intergenic
1116676147 14:47908359-47908381 CTGTGTCATCCCATGGCTGAAGG + Intergenic
1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG + Intergenic
1117896026 14:60487432-60487454 ATTTGTGACCACATGGATGATGG - Intronic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1122667623 14:103344054-103344076 CTGTGTGACCCCAAGGGGACAGG + Exonic
1122953379 14:105058689-105058711 CTGTGTCACCCACAGCATGAGGG + Intronic
1125748228 15:42011810-42011832 CTGGGTTGTCCCAAGGATGAGGG + Intronic
1130938233 15:88487966-88487988 CTGTGTCATCCCATGGAGGAAGG + Intergenic
1131677141 15:94682142-94682164 CTGTGGGACACCAGGCATGAAGG - Intergenic
1131713105 15:95077373-95077395 CTATTTGACCCCAAAGACGATGG - Intergenic
1132722568 16:1323964-1323986 CAGTGTGACCCTGAGGATGGGGG - Intronic
1132998920 16:2839439-2839461 CGCTGTGACCCTAACGATGAAGG + Intronic
1133213833 16:4278595-4278617 CTCTGTGTCCCCAAGGAACATGG + Intergenic
1135415224 16:22263813-22263835 CTGTGAGGCCCCAGGGAGGAGGG + Intronic
1136727821 16:32375892-32375914 CTGTGTGTCACCAAGGTTTATGG - Intergenic
1137576616 16:49604268-49604290 CTCTGTGACCCCAATGGTGAGGG - Intronic
1138177519 16:54914656-54914678 CTTTGGGACCCCAGGCATGATGG - Intergenic
1138557661 16:57781913-57781935 CTGTGTGGCCCCATGGTTAAGGG - Intronic
1139613549 16:68075540-68075562 CAGTGGGACCCCAAGGGTGCTGG - Intronic
1140081732 16:71754551-71754573 CTTTGGGACGCCAAGGAGGAAGG + Intronic
1140133608 16:72185475-72185497 CTGAGTGAACCCAAAGATGATGG - Intergenic
1141087929 16:81110167-81110189 CTCTGTGCCCACCAGGATGAGGG + Intergenic
1141419636 16:83904914-83904936 CTGTGTGACCCCATGGGGGCCGG - Intronic
1202998614 16_KI270728v1_random:141862-141884 CTGTGTGTCACCAAGGTTTATGG + Intergenic
1203130211 16_KI270728v1_random:1678266-1678288 CTGTGTGTCACCAAGGTTTATGG + Intergenic
1143012528 17:3873739-3873761 CCGTGTGACCCTCTGGATGAAGG - Intronic
1143710280 17:8729780-8729802 GTGTGTGAGCCCAAAGGTGAGGG + Intergenic
1149264032 17:54908197-54908219 TACTGTGACCCCAAGGATGAAGG - Intronic
1153336029 18:3925639-3925661 CTGTGTGCCCGGAAGTATGAAGG - Intronic
1155697299 18:28698219-28698241 AAGTGTGACCCCAAGATTGAAGG + Intergenic
1157105492 18:44770922-44770944 CTGTGTGGCCCTTAGAATGAGGG + Intronic
1158941602 18:62410165-62410187 CTGTGTGACCCCAAGCTTTATGG - Intergenic
1160514029 18:79468852-79468874 CTCTGTGACCCCCAGGATTGTGG + Intronic
1162566271 19:11447075-11447097 CTGTGTGTCCCCACTGAGGAGGG - Exonic
1163375551 19:16928052-16928074 GTGTGGGACCCCCAGGGTGAAGG + Exonic
1163467057 19:17474405-17474427 CTGGGTGAACCCAAGAAGGAAGG - Intronic
1163795874 19:19337774-19337796 CTGTGTGGATCCCAGGATGAGGG - Intronic
1165247114 19:34504182-34504204 CTGAGTGACTCCGAGAATGAGGG + Exonic
1165408486 19:35644330-35644352 CTGTGCGACCCCAAAGAGGTGGG + Exonic
1167870985 19:52370037-52370059 CTGTGTGACCCCTGAGATGCCGG - Intronic
1168710642 19:58498183-58498205 CTGTGTAACGCCAAGGGTGTGGG - Intronic
925671032 2:6310107-6310129 CTCTGTGGCCCCAAAGATGCTGG - Intergenic
927174648 2:20397062-20397084 TTCTGTGACCCCAAGGATCTGGG + Intergenic
928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG + Intronic
929456984 2:42073012-42073034 CTGTGCTATCCCCAGGATGAGGG + Intergenic
929668567 2:43852275-43852297 CATTGTGACCCCAAGGATAAAGG - Intronic
930746845 2:54893371-54893393 CTGTGTTACCCAATGGCTGAAGG + Intronic
930768209 2:55106426-55106448 CTGTGTGAGGCCCTGGATGAGGG - Intronic
930920250 2:56744512-56744534 CAGTGTGCACCCAAGGTTGAAGG - Intergenic
931277297 2:60755057-60755079 CTTTGTGACGCCAAGGCTGGTGG - Intergenic
932660785 2:73649943-73649965 CTGCTTGAGCCCAAGGATTAGGG - Intergenic
933840958 2:86285127-86285149 CTCTGTGAACCCAAGGCTGAGGG - Intronic
933996599 2:87674600-87674622 CTGGGTGAACCCCAGGAGGAGGG - Intergenic
934609011 2:95720787-95720809 CTGGGTGGCCCCAAAAATGAAGG - Intergenic
934616272 2:95773150-95773172 ATTTGTGACCCTGAGGATGAAGG + Intergenic
934644623 2:96051410-96051432 ATTTGTGACCCTGAGGATGAAGG - Intergenic
934681959 2:96290468-96290490 CAGTATGACACCAAGGGTGAAGG - Exonic
934838038 2:97607500-97607522 ATTTGTGACCCTGAGGATGAAGG - Intergenic
935351023 2:102151952-102151974 CTGCCTGACCCCTGGGATGAGGG - Intronic
936297253 2:111276310-111276332 CTGGGTGAACCCCAGGAGGAGGG + Intergenic
936779386 2:116013920-116013942 CTGTGTGCTTCCAGGGATGATGG + Intergenic
937296532 2:120812917-120812939 CTGTGTGTCCCCACTGAAGAAGG + Intronic
940187799 2:151005776-151005798 CTCAGTGGCTCCAAGGATGAGGG + Intronic
941233809 2:162944395-162944417 CAGTGTGACACCAACTATGAAGG + Intergenic
941677373 2:168357850-168357872 CTGTGTGAGGCCAAGGAAGGAGG - Intergenic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
942167425 2:173255366-173255388 CTGTGTGACTCCAAAGCTGGAGG - Intronic
946538395 2:220657332-220657354 CTTTGTAACCCCAAGGTTGCAGG - Intergenic
947906126 2:233764702-233764724 CTGTGTCTCCCCAAGAAAGAGGG + Intronic
948716673 2:239869743-239869765 CAGGGTGACCCCAAGCATCACGG - Intergenic
1171174343 20:23040286-23040308 CTATGCCACCTCAAGGATGAGGG + Intergenic
1172772509 20:37389718-37389740 CTGGCTGGCCCCAAGGATTAGGG + Intronic
1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG + Intergenic
1174263052 20:49311375-49311397 CAGTGTGACTCCAGTGATGATGG + Intergenic
1174639511 20:52031382-52031404 GTGTGTGACCACAAGGGTGATGG - Intergenic
1175552352 20:59825819-59825841 ATGTGTCACCCCCAGTATGATGG + Intronic
1175604320 20:60299734-60299756 CTATGTGACCCCAGGGAGGTTGG + Intergenic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1176967964 21:15232710-15232732 CTGTCCTACCCCATGGATGAAGG - Intergenic
1177287453 21:19071002-19071024 ATATTTGTCCCCAAGGATGAAGG + Intergenic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1179358851 21:40686781-40686803 CTGTGTGACACCAAGAATGGGGG - Intronic
1179542606 21:42093460-42093482 CTTTGTGAGGCCAAGGAGGAAGG - Intronic
1179909247 21:44439198-44439220 CTGTGTGTCCCCAGGGCTGCAGG + Intronic
1180501105 22:15929916-15929938 TTATGTGACCCCAAGGGAGAGGG - Intergenic
1180544844 22:16491048-16491070 CTGTGTGCCACCAAGGTTTATGG + Intergenic
1180840407 22:18956452-18956474 CTGTTTGACCCCAAACATCATGG + Intergenic
1181061084 22:20282324-20282346 CTGTTTGACCCCAAACATCATGG - Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1182342112 22:29631622-29631644 CTGCTTCACACCAAGGATGATGG - Intronic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1184090642 22:42291316-42291338 CTGTCTAACCCCAAGGCTGTGGG - Intronic
1184505035 22:44895373-44895395 CTGTGTGACCTTACGGATGAGGG - Intronic
1184973764 22:48046465-48046487 CTGGGTGACTCCAAGGACCAGGG + Intergenic
950144756 3:10641014-10641036 GTGTGTGACCCCAGGCAGGAGGG + Intronic
950748181 3:15107588-15107610 GTGTGAGAGCCCAAGGGTGAGGG + Intergenic
953378982 3:42452260-42452282 GTGTGTGACCCCCAGGAGGTGGG - Intergenic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955701154 3:61683517-61683539 CCAAGTAACCCCAAGGATGAGGG - Intronic
956237492 3:67090541-67090563 CACTGAAACCCCAAGGATGATGG + Intergenic
959597850 3:108147147-108147169 CTGTGAGAGGCCAAGGATGTGGG + Intergenic
960128392 3:114025813-114025835 ATGTGTGTGGCCAAGGATGAAGG - Intronic
961000923 3:123373509-123373531 CTGTGAGACCCTATGGATGGGGG - Intronic
962002752 3:131316432-131316454 CTGTGTCATGCCTAGGATGATGG - Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
963082588 3:141408301-141408323 CTGTGGGAGGCCAAGGCTGATGG + Intronic
964956943 3:162370965-162370987 CTCTGTGACCACAAAGAAGAAGG - Intergenic
965186432 3:165471345-165471367 CTGTGTGAACCTAAGGGTGTGGG - Intergenic
966215521 3:177498276-177498298 GTTTGTGCCCACAAGGATGAGGG - Intergenic
966388681 3:179428942-179428964 CTGAGTGCCCCTAAGGATGGAGG + Intronic
968229434 3:196996619-196996641 CTGGGTCACCCCACAGATGAAGG + Intronic
968972255 4:3802185-3802207 CTGGGGCACCCCAAGGAGGATGG + Intergenic
970518907 4:16863011-16863033 CTCTGTGACTCCAACGATGCGGG - Intronic
970520102 4:16874723-16874745 CTTTGTGCCACCAAGGATGTTGG - Intronic
971487908 4:27179758-27179780 CTGTGTGACCCCAAAGTCCAGGG - Intergenic
972185747 4:36525717-36525739 CTAACTGCCCCCAAGGATGAAGG - Intergenic
975358938 4:73443550-73443572 CTTTGTGACCCCTTTGATGAGGG + Intronic
977017500 4:91710277-91710299 CTGTGGGAGGCCAAGGAAGAGGG + Intergenic
980992791 4:139752504-139752526 CTTTTTGACCCCAAAGAAGACGG - Intronic
982233900 4:153234277-153234299 CAGTGTGACTGCAAGGATAAAGG - Intronic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
982782371 4:159504736-159504758 CTGCGTGACCCAAGGGTTGATGG - Intergenic
983370165 4:166848367-166848389 CTGATTGGCCCCAAGGATGCTGG - Intronic
985531461 5:436163-436185 CTGTGGGAGCCCATGGGTGAGGG + Exonic
985971981 5:3385419-3385441 CTTTGTGACCCCAGAGAAGAGGG - Intergenic
986105299 5:4654039-4654061 CTCTGTGACTCCAAGGATCTTGG + Intergenic
986238180 5:5932146-5932168 CTGATTGACACCGAGGATGAAGG - Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
986703607 5:10435959-10435981 CTTTGGGAGCCCAAGGAGGACGG - Exonic
987026071 5:13927891-13927913 CTGTTTCACCTCAAGGATGGAGG - Intronic
987425812 5:17771617-17771639 TTCTATGAGCCCAAGGATGAAGG + Intergenic
990732273 5:58822465-58822487 CTGTGTCAAGCCATGGATGAGGG + Intronic
991491516 5:67188236-67188258 CTGTGTGATTCCATGGAGGAAGG - Intronic
992118380 5:73564970-73564992 CTGTCAGAGCCCAGGGATGAAGG + Intronic
995506980 5:112870793-112870815 CTGTGTGATCCCATGGTGGAAGG - Intronic
998134948 5:139669644-139669666 TTGTGTGACCCCAAGGACACAGG + Intronic
998511329 5:142716918-142716940 CTGGGTGACGCCAAGGCTGCTGG - Intergenic
1000205396 5:159053133-159053155 GTGTCTGACCCCAAAGATCAGGG - Intronic
1000920403 5:167130742-167130764 GTGTGAGACCCCAAGGAGGGTGG - Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001277645 5:170362205-170362227 CTGTGTGACTCCAAGCAGGCCGG - Intronic
1002600232 5:180350213-180350235 CTGGGTGACCCCTTGGGTGATGG - Intronic
1003724423 6:8744306-8744328 CTGTGTCATCCCATGGACGAAGG - Intergenic
1003780210 6:9415987-9416009 CTGTGACCCCCCAAGGATGAGGG + Intergenic
1004307334 6:14512801-14512823 CTGTGTGACCTCAGTGGTGAAGG - Intergenic
1006926097 6:37655928-37655950 CTGGGTGACCCCAAGGTTGGGGG + Intronic
1007993744 6:46284308-46284330 CTCTGTGACTCCAGGGATGTGGG + Intronic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011309824 6:85969641-85969663 CTGTGTGCCCCCAAGGTTTTGGG - Intergenic
1011400777 6:86959134-86959156 CTGAGTTTCCCCAAGGAAGAGGG - Intronic
1012143577 6:95653115-95653137 CTATGTGACCCTAAGTTTGATGG + Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013543730 6:111135659-111135681 CTGTTTTACCCCAAGGATTCAGG + Intronic
1015947065 6:138513690-138513712 ATCTGAGACCCGAAGGATGATGG - Intronic
1016071606 6:139746116-139746138 CTGTGTGACTGAAAGAATGAAGG + Intergenic
1020105291 7:5419897-5419919 CTGAGAGACCCCAAGGAAGAGGG + Intronic
1020884035 7:13800511-13800533 CTGTGTGACCCTAATGAGGTGGG + Intergenic
1021276147 7:18653946-18653968 GTATGTGACCACAAGCATGAAGG - Intronic
1021873765 7:25029398-25029420 CTGTGTGACCCCATGCAGGCTGG - Intergenic
1024231398 7:47366650-47366672 CTGTGTGACTCCAAAGAGGATGG + Intronic
1024296795 7:47850386-47850408 CTTTGGGACGCCAAGGAGGATGG + Intronic
1024968977 7:55051493-55051515 CTGTGTCACCCCACGGCAGAAGG - Intronic
1026116184 7:67497637-67497659 CTGTGAGACCCCTAGGATGTGGG + Intergenic
1028841321 7:95432913-95432935 CTCTGGAACCCCAGGGATGAGGG - Intronic
1029172254 7:98639474-98639496 CTGTCTGCCCCAAAGGGTGATGG + Intergenic
1029606579 7:101602768-101602790 CTGTGTGACCTCAAGGCTAGTGG - Intergenic
1035474989 7:159136939-159136961 GTGTGAGAGCCCAAGGATGGAGG + Intronic
1036635945 8:10549500-10549522 CTGTGTGACCCCCAGTGTGCTGG - Intronic
1038325637 8:26570774-26570796 CTGTGTGACCCCAAAGCCCAAGG - Intronic
1038547935 8:28440361-28440383 CTGGGAAACCCCAAGGATGGAGG - Intronic
1039304915 8:36250955-36250977 CTTTCTGACCCCAAAGATAATGG - Intergenic
1040515382 8:48130328-48130350 CTGTGTGAGCACAAGAATTATGG - Intergenic
1041012560 8:53558910-53558932 CTGTGAGACCACAAAGATGGTGG - Intergenic
1045655863 8:104385819-104385841 CTGTGTCATCCCATGGAGGAAGG - Intronic
1046971680 8:120230123-120230145 CTTTGGGAGGCCAAGGATGAAGG - Intronic
1057090328 9:92252164-92252186 CTGTAGGACCCGAAGGCTGAAGG + Intronic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1061509614 9:131052631-131052653 CTGTCTGGCCCCCAGGATGCCGG + Exonic
1062075549 9:134586635-134586657 TTGTGTGGCCCAGAGGATGAGGG + Intergenic
1062434337 9:136540047-136540069 CTGTGTGACCCTGGGGCTGATGG + Intronic
1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG + Intergenic
1191847352 X:65557354-65557376 CTTTGTGCCTCCAAGGGTGAGGG + Intergenic
1193143152 X:78050835-78050857 CTGAGTAACCCCAAGGATTTGGG - Intergenic
1195703510 X:107722374-107722396 CTGAGTGACACAAGGGATGACGG + Intronic
1197891093 X:131271313-131271335 GTGTGTGAGCCCAAGGATGAGGG + Intergenic
1198640396 X:138749807-138749829 ATGTGTGACCCCCTGGATCACGG + Intronic
1199782923 X:151080070-151080092 CTGGGTGCCCCCTGGGATGAGGG + Intergenic
1200697917 Y:6377329-6377351 CTCTGTGAGGCCAAGGATAAAGG - Intergenic
1200916515 Y:8576012-8576034 CACTGTGACTCCCAGGATGAAGG + Intergenic
1200919132 Y:8597556-8597578 CTTTGTGAGGCCCAGGATGAAGG + Intergenic
1200926311 Y:8658093-8658115 CCGTGTGAGGCCAAGGATGAAGG + Intergenic
1201036195 Y:9787370-9787392 CTCTGTGAGGCCAAGGATAAAGG + Intergenic
1202125400 Y:21565058-21565080 CCCTGTGAGGCCAAGGATGAAGG + Intergenic
1202153608 Y:21864334-21864356 CCCTGTGAGGCCAAGGATGAAGG - Intergenic
1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202464730 Y:25143384-25143406 CTGTGTGAGTCCAAGTATGAGGG - Intergenic