ID: 928088343

View in Genome Browser
Species Human (GRCh38)
Location 2:28359367-28359389
Sequence CTTCTGGTTTATCTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928088336_928088343 5 Left 928088336 2:28359339-28359361 CCCCAGGACCAGCTGAGCAGTAA No data
Right 928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG No data
928088339_928088343 -3 Left 928088339 2:28359347-28359369 CCAGCTGAGCAGTAAAGTCTCTT No data
Right 928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG No data
928088335_928088343 11 Left 928088335 2:28359333-28359355 CCATTTCCCCAGGACCAGCTGAG No data
Right 928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG No data
928088337_928088343 4 Left 928088337 2:28359340-28359362 CCCAGGACCAGCTGAGCAGTAAA No data
Right 928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG No data
928088338_928088343 3 Left 928088338 2:28359341-28359363 CCAGGACCAGCTGAGCAGTAAAG No data
Right 928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG No data
928088333_928088343 30 Left 928088333 2:28359314-28359336 CCACGAGTCAGGGCAGGCACCAT No data
Right 928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928088343 Original CRISPR CTTCTGGTTTATCTGGAGGA AGG Intergenic
No off target data available for this crispr