ID: 928088934

View in Genome Browser
Species Human (GRCh38)
Location 2:28362293-28362315
Sequence TCCCGCATCCTCCTTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928088934_928088935 -9 Left 928088934 2:28362293-28362315 CCAGTAGGAAGGAGGATGCGGGA No data
Right 928088935 2:28362307-28362329 GATGCGGGAGCCAGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928088934 Original CRISPR TCCCGCATCCTCCTTCCTAC TGG (reversed) Intergenic
No off target data available for this crispr