ID: 928092124

View in Genome Browser
Species Human (GRCh38)
Location 2:28381420-28381442
Sequence ACTTACCTGCACAAGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928092124_928092125 -6 Left 928092124 2:28381420-28381442 CCTGTCTTCTTGTGCAGGTAAGT No data
Right 928092125 2:28381437-28381459 GTAAGTCGCCTTCTAGCTACTGG No data
928092124_928092128 -1 Left 928092124 2:28381420-28381442 CCTGTCTTCTTGTGCAGGTAAGT No data
Right 928092128 2:28381442-28381464 TCGCCTTCTAGCTACTGGGGTGG No data
928092124_928092129 0 Left 928092124 2:28381420-28381442 CCTGTCTTCTTGTGCAGGTAAGT No data
Right 928092129 2:28381443-28381465 CGCCTTCTAGCTACTGGGGTGGG No data
928092124_928092130 1 Left 928092124 2:28381420-28381442 CCTGTCTTCTTGTGCAGGTAAGT No data
Right 928092130 2:28381444-28381466 GCCTTCTAGCTACTGGGGTGGGG No data
928092124_928092127 -4 Left 928092124 2:28381420-28381442 CCTGTCTTCTTGTGCAGGTAAGT No data
Right 928092127 2:28381439-28381461 AAGTCGCCTTCTAGCTACTGGGG No data
928092124_928092126 -5 Left 928092124 2:28381420-28381442 CCTGTCTTCTTGTGCAGGTAAGT No data
Right 928092126 2:28381438-28381460 TAAGTCGCCTTCTAGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928092124 Original CRISPR ACTTACCTGCACAAGAAGAC AGG (reversed) Intergenic
No off target data available for this crispr