ID: 928092663

View in Genome Browser
Species Human (GRCh38)
Location 2:28385117-28385139
Sequence CAGGGCAGACAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928092663_928092672 23 Left 928092663 2:28385117-28385139 CCTTCCTCATGCTGTCTGCCCTG No data
Right 928092672 2:28385163-28385185 AACATCCTATCAGACTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928092663 Original CRISPR CAGGGCAGACAGCATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr