ID: 928093281

View in Genome Browser
Species Human (GRCh38)
Location 2:28389591-28389613
Sequence TGGCCTCTTCTCTAAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928093266_928093281 20 Left 928093266 2:28389548-28389570 CCACCCCAGCTTCCCTCTTCCCC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093277_928093281 -6 Left 928093277 2:28389574-28389596 CCTTCCCTCACTTGACATGGCCT No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093270_928093281 8 Left 928093270 2:28389560-28389582 CCCTCTTCCCCTTCCCTTCCCTC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093273_928093281 0 Left 928093273 2:28389568-28389590 CCCTTCCCTTCCCTCACTTGACA No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093272_928093281 1 Left 928093272 2:28389567-28389589 CCCCTTCCCTTCCCTCACTTGAC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093264_928093281 30 Left 928093264 2:28389538-28389560 CCTTTTCTTCCCACCCCAGCTTC 0: 2
1: 0
2: 7
3: 105
4: 895
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093268_928093281 16 Left 928093268 2:28389552-28389574 CCCAGCTTCCCTCTTCCCCTTCC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093269_928093281 15 Left 928093269 2:28389553-28389575 CCAGCTTCCCTCTTCCCCTTCCC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093276_928093281 -5 Left 928093276 2:28389573-28389595 CCCTTCCCTCACTTGACATGGCC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093267_928093281 17 Left 928093267 2:28389551-28389573 CCCCAGCTTCCCTCTTCCCCTTC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093278_928093281 -10 Left 928093278 2:28389578-28389600 CCCTCACTTGACATGGCCTCTTC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093265_928093281 21 Left 928093265 2:28389547-28389569 CCCACCCCAGCTTCCCTCTTCCC No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093274_928093281 -1 Left 928093274 2:28389569-28389591 CCTTCCCTTCCCTCACTTGACAT No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data
928093271_928093281 7 Left 928093271 2:28389561-28389583 CCTCTTCCCCTTCCCTTCCCTCA No data
Right 928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928093281 Original CRISPR TGGCCTCTTCTCTAAGCTGA GGG Intergenic
No off target data available for this crispr