ID: 928097305

View in Genome Browser
Species Human (GRCh38)
Location 2:28412526-28412548
Sequence TCCAGGGCCGTGAGGGCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 202}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928097298_928097305 1 Left 928097298 2:28412502-28412524 CCAGGGACCAGCACCTTCAAGCG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097294_928097305 16 Left 928097294 2:28412487-28412509 CCTCGCTCCTCCTTCCCAGGGAC 0: 1
1: 0
2: 4
3: 44
4: 490
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097291_928097305 19 Left 928097291 2:28412484-28412506 CCTCCTCGCTCCTCCTTCCCAGG 0: 1
1: 0
2: 3
3: 87
4: 734
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097296_928097305 6 Left 928097296 2:28412497-28412519 CCTTCCCAGGGACCAGCACCTTC 0: 1
1: 0
2: 4
3: 48
4: 387
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097297_928097305 2 Left 928097297 2:28412501-28412523 CCCAGGGACCAGCACCTTCAAGC 0: 1
1: 0
2: 2
3: 17
4: 150
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097295_928097305 9 Left 928097295 2:28412494-28412516 CCTCCTTCCCAGGGACCAGCACC 0: 1
1: 0
2: 1
3: 63
4: 499
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097299_928097305 -6 Left 928097299 2:28412509-28412531 CCAGCACCTTCAAGCGCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 173
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
928097290_928097305 30 Left 928097290 2:28412473-28412495 CCGGAGGGGGTCCTCCTCGCTCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928097305 Original CRISPR TCCAGGGCCGTGAGGGCAAG AGG Exonic
900238598 1:1604111-1604133 TCCAGGGCCTTCAGGGAAGGTGG + Intergenic
900389733 1:2428750-2428772 TCCAGGGCCCTGAGGCTGAGGGG + Intronic
900864550 1:5258877-5258899 TCCATGGCCTTGGGGGGAAGGGG - Intergenic
901506746 1:9689859-9689881 TCCGGGGCCGTGGGGGCTTGGGG + Intronic
903272135 1:22196221-22196243 CCCAGATCAGTGAGGGCAAGTGG - Intergenic
904903304 1:33874958-33874980 GCCAGGGCTGTGCGGGCCAGAGG - Intronic
910240326 1:85079547-85079569 TCCAGGGGCGTGGGTGCTAGAGG + Intronic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
914095456 1:144540609-144540631 TCCTGGGGCGGGAGGGCAGGAGG + Intergenic
914303069 1:146393284-146393306 TCCTGGGGCGGGAGGGCAGGAGG - Intergenic
915668293 1:157464927-157464949 TGCAGGGCCGTAAGGGCCAATGG - Intergenic
916504609 1:165416790-165416812 TCCAGAGCAGAGAGGGCAAGAGG - Intronic
916655994 1:166875976-166875998 TCCAGGGCGGTGAGTTCAGGTGG + Intronic
917838442 1:178958931-178958953 TGCTGGGCCCTGAGGGAAAGAGG + Intergenic
919939323 1:202275639-202275661 TCAAGGGCCCAGGGGGCAAGGGG - Intronic
920522094 1:206635500-206635522 TCCAGGGGCGGGAGGGGGAGCGG - Intergenic
920666088 1:207963825-207963847 TCCAGGTCCGCGCGGGCCAGGGG + Intergenic
920670597 1:208001241-208001263 TTCTGGGCCCAGAGGGCAAGAGG - Intergenic
921392448 1:214630325-214630347 TCCAGGTCTCTGAGGGAAAGGGG - Intronic
922748852 1:228061491-228061513 CCCAGGGCCGTGATGGGCAGGGG + Intergenic
1062770115 10:92471-92493 TCCAAGCCTGTGAGGGAAAGGGG + Intergenic
1062994806 10:1855825-1855847 TTCAGGGCCAACAGGGCAAGTGG + Intergenic
1063294211 10:4786508-4786530 TCAAGGGCAGTGAAGGCAGGTGG + Intergenic
1063907658 10:10797700-10797722 TCCAGGATCCTGAGGGCAGGAGG + Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1064587041 10:16849694-16849716 GCCATGGCGGTGATGGCAAGAGG - Intronic
1065046316 10:21750244-21750266 GACAAGGCTGTGAGGGCAAGAGG + Intergenic
1067478313 10:46580097-46580119 GCCAGGGCTGTGAGGGAGAGTGG + Intronic
1067616426 10:47761690-47761712 GCCAGGGCTGTGAGGGAGAGTGG - Intergenic
1067954505 10:50777439-50777461 GCCAGGGACCTGAGAGCAAGGGG + Intronic
1070774858 10:79103582-79103604 TCTAGGGGAGGGAGGGCAAGGGG + Intronic
1071764051 10:88641792-88641814 TCTAGGGCCCTGAGGCTAAGTGG + Intergenic
1072523996 10:96255230-96255252 TCCAGGGCCAAGAGGGCACGGGG + Intronic
1073390905 10:103175763-103175785 TCCAGGGTGCTGAGGCCAAGGGG + Intronic
1075777063 10:124995969-124995991 TCCAGGGCCTGGAGGGCCTGTGG + Intronic
1075782625 10:125026899-125026921 TCCAGGGTCCTGGTGGCAAGAGG - Exonic
1077015261 11:396476-396498 TCCAGGGCAGGGAGGCCAGGGGG - Intronic
1077507831 11:2940346-2940368 TGCAGGGCTGGGAGGACAAGAGG - Intergenic
1078438096 11:11342057-11342079 TCAAGGGCTGTGGGGGCCAGAGG - Intronic
1080020339 11:27553413-27553435 TCCAGAGTGGTGAGGCCAAGTGG - Intergenic
1082003948 11:47409571-47409593 CCCAGGGCACTGAGGGCAACAGG - Intronic
1083771978 11:64872811-64872833 GCTAGGGCTGTGAGGGCATGGGG - Intronic
1084731467 11:71076243-71076265 CCCAGGGTCGGGAGGGAAAGAGG + Intronic
1084798463 11:71525555-71525577 TGCAGGGCAGTGAGGGCCTGGGG - Intergenic
1087800721 11:102500965-102500987 TCCAGGGCCTTTGGGGGAAGGGG - Intergenic
1088208538 11:107424537-107424559 TCCTGGGAAGTGAGGGGAAGAGG - Intronic
1088715712 11:112547430-112547452 TCCAGGGCTCTGAGAGGAAGGGG - Intergenic
1089310734 11:117556627-117556649 TCCAGGGCCCTGGGGTCAGGTGG - Intronic
1092867753 12:12778945-12778967 TCCAGTGCCATGTGGGAAAGAGG - Intronic
1097040577 12:56153753-56153775 GCCAGGGGAGTGAGGGCAGGCGG + Intronic
1097130041 12:56805034-56805056 TCCAAGCCTGTGAGGGCAGGGGG + Intergenic
1101269273 12:103126019-103126041 TCCAGGGCAGTGAGTGCAATTGG + Intergenic
1103133408 12:118487771-118487793 GCCAGAGGCTTGAGGGCAAGAGG + Intergenic
1103444161 12:120983109-120983131 CCCAGGGGCCAGAGGGCAAGAGG + Intronic
1103724462 12:122990844-122990866 CTCAGGGCCGTGAGAGGAAGGGG + Intronic
1104407916 12:128533856-128533878 TACAGGGCCCAGAGGCCAAGTGG + Intronic
1104546581 12:129718338-129718360 TCCAGGGAGGGGAGGGGAAGGGG + Intronic
1106119661 13:26849632-26849654 TCCAGGGCTGTTAGTGCAAAGGG - Intergenic
1106318761 13:28618824-28618846 TGCCGGGCCTCGAGGGCAAGTGG + Intergenic
1108314011 13:49220628-49220650 CCCAGGGCCGCGAGCGCCAGAGG - Exonic
1108668247 13:52653519-52653541 TTCAGGGACGTGAGGGAAAAGGG - Intronic
1113594629 13:111522243-111522265 TGCAGATCCGTGAGAGCAAGGGG - Intergenic
1113806696 13:113114179-113114201 CCCAGGGCCGGGAGCCCAAGGGG - Intronic
1114229583 14:20768409-20768431 TCCAGGGCCCTGAGGAAAGGAGG + Exonic
1115745357 14:36431027-36431049 TCCAGGGAAGTGAGCGAAAGAGG + Intergenic
1116388324 14:44359956-44359978 TCCTGGACAGTGAGGGCAAGGGG - Intergenic
1116820382 14:49621242-49621264 TCCAGGGCCGGGAGCGCAGGCGG - Exonic
1119444579 14:74652673-74652695 TCCAGGCCCCTGATGGGAAGTGG - Intergenic
1121733619 14:96203291-96203313 TCCAAGGCCATCAGGGCAGGTGG + Intergenic
1122672719 14:103384838-103384860 ACCAGCTCCTTGAGGGCAAGAGG + Intergenic
1126968597 15:54083997-54084019 TCCAGGGCTGTGAGTGCAGGGGG + Intronic
1128341266 15:66824046-66824068 TTCAGGGCCTTGAGGGCCATGGG + Intergenic
1128768676 15:70266257-70266279 ACCAGCACCGTGAGGCCAAGGGG + Intergenic
1130891528 15:88137619-88137641 CCCAGGGCTATGAGGACAAGGGG + Intronic
1131310743 15:91287857-91287879 TCTATGGCTGTGAGGACAAGGGG + Intronic
1132566309 16:625170-625192 TCCAGGGGAGGGAGGGGAAGCGG + Intronic
1132693129 16:1190552-1190574 TCCAGGGCAGGGAGGGCTGGTGG + Intronic
1132946548 16:2534738-2534760 ACCAGGGCCTTGTGGGCCAGAGG + Intergenic
1133225058 16:4337081-4337103 GCCAGGGCACTGAGGTCAAGGGG - Exonic
1133239442 16:4405593-4405615 TCCCGGGCAGTGAGGGCACCAGG + Intronic
1134584067 16:15396010-15396032 TGCAGGGCCGCGAGGCCAACTGG + Exonic
1135239428 16:20790902-20790924 TCCAGGTCCACGAAGGCAAGAGG + Intronic
1135982265 16:27157071-27157093 TTCAAGGCCGTGATGGAAAGAGG + Intergenic
1136452191 16:30359691-30359713 TCCTGGGCCGGGAGGGGCAGGGG - Intronic
1137251813 16:46746842-46746864 TGCAGGGCAGGGAGGGGAAGGGG + Intronic
1137676033 16:50304305-50304327 TCCTGGGCCGAGAGGGGAGGAGG + Intronic
1139376639 16:66502804-66502826 TCCAGGGACGTGAGTGAGAGAGG - Intronic
1139948980 16:70660175-70660197 TCCAGGGTGCTCAGGGCAAGAGG - Exonic
1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143796589 17:9342040-9342062 TCCACGGCCTGGAGGGGAAGGGG + Intronic
1144790598 17:17856464-17856486 CCCAGAGCCGTGGGAGCAAGGGG - Intronic
1145071144 17:19809259-19809281 ATCAGGGCCTTGAGGGGAAGGGG + Intronic
1146626755 17:34440724-34440746 TCCAGGGCAGTCAGGGGATGGGG + Intergenic
1146632828 17:34483173-34483195 ACCAGAGCCCAGAGGGCAAGAGG + Intergenic
1146821441 17:35986143-35986165 TCCATGTCCTTGAGGGCAAGGGG + Intronic
1148684650 17:49494865-49494887 TGAAGGGCAGGGAGGGCAAGCGG + Intergenic
1148759697 17:49993362-49993384 TCCAGGGCCGCGGGGGCGCGCGG - Intronic
1149124888 17:53217081-53217103 TCGGGGGCCGGGGGGGCAAGGGG - Intergenic
1150281699 17:63932665-63932687 TCCTGGGCCGTGAGCGAAATAGG + Intergenic
1151318260 17:73337194-73337216 GCCAGGGCGGGGAGGGGAAGGGG - Exonic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1152728960 17:81960731-81960753 TCCACGGCCGTGAAGTCCAGCGG + Exonic
1155508122 18:26550438-26550460 TCCAGGGCCGGGCAGGCACGCGG - Intronic
1157533482 18:48441609-48441631 TCCAGGTCCCTGGGGGCAAAAGG + Intergenic
1160593940 18:79961637-79961659 TCCAGGCTCGTGTGGGCCAGTGG + Intergenic
1160685511 19:434713-434735 TCGAGGGCCGTGAGGGCGCAGGG + Exonic
1160763420 19:797015-797037 GCCTGGGCCGTGAGGGCAAAGGG - Intergenic
1161357052 19:3825038-3825060 TTCAGGGCGGTGTGGGCCAGTGG + Intronic
1162410028 19:10500063-10500085 TCCAGGTCCCTGAGTGCCAGAGG - Exonic
1162456630 19:10788880-10788902 GCCAGGGCTGTGATGGCCAGAGG - Intronic
1162775212 19:12975178-12975200 TCCAGGGCCCTTCGAGCAAGGGG - Intergenic
1163721142 19:18898820-18898842 CACAGGGCTGTGAGGTCAAGGGG - Intergenic
1166147252 19:40846132-40846154 AGAAGGGCCCTGAGGGCAAGAGG - Intronic
1166151404 19:40878028-40878050 AGAAGGGCCCTGAGGGCAAGAGG - Intronic
925421801 2:3718586-3718608 TCCAGGGCCTTGTGGACTAGGGG + Intronic
927991900 2:27453946-27453968 TGCAGGGCCATGAGGGGAGGGGG - Intronic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
933947239 2:87297147-87297169 TCCAGGCCTGTGATGGCAAGAGG + Intergenic
934572579 2:95382262-95382284 TCCAAGGCAGTGAGTGCGAGGGG - Intronic
936332953 2:111564421-111564443 TCCAGGCCTGTGATGGCAAGAGG - Intergenic
938770834 2:134499453-134499475 TCCAGGGCTGTGTGGGCAAATGG - Intronic
940987625 2:160064141-160064163 TCCAGGGCAGTGAGAGTAAAGGG + Intergenic
945198090 2:207256099-207256121 TCCAAGGCGGTGAAGGCAGGAGG + Intergenic
945983999 2:216340000-216340022 CCCAGGGACTTGAGGGAAAGGGG - Intronic
946666801 2:222058991-222059013 TCCAGGGCGGGGAGGGGATGAGG + Intergenic
1170963319 20:21044467-21044489 GCAAGGGTGGTGAGGGCAAGGGG + Intergenic
1171227783 20:23455839-23455861 TGCAGGGCCAGGAGGGCAAGTGG - Intergenic
1171343107 20:24445833-24445855 TCGAGGGCAGGGAGGACAAGTGG - Intergenic
1172126608 20:32628276-32628298 TGCAGGGCCCTGAGGGGCAGTGG - Intergenic
1172846992 20:37935475-37935497 GCCAGGGTCGGGAGGGGAAGGGG - Intronic
1175404255 20:58716597-58716619 TCCAGGGCTGTGGGGGCACATGG - Intronic
1175442517 20:59001690-59001712 TCCAGGTCCGTTCGGGGAAGTGG - Intronic
1176085415 20:63293519-63293541 TCCAGGGCTGTGGGGGAACGAGG + Intronic
1176443553 21:6799399-6799421 TCCTGGGCTGAGAGGGAAAGAGG + Intergenic
1176733870 21:10524372-10524394 CCCAGTACCGTGAGGGTAAGGGG - Intronic
1178027413 21:28483785-28483807 TCCAGGGGCCTGAGGTCAGGAGG + Intergenic
1178686075 21:34711686-34711708 GCCAGGACCGAGAGGGGAAGAGG - Intronic
1179044287 21:37830949-37830971 TCCTGGGCAGTGAGTGCAGGAGG + Intronic
1179511416 21:41876584-41876606 CCCAGGGCCATGACTGCAAGAGG + Intronic
1180561623 22:16619845-16619867 CCCAGTACCGTGAGGGTAAGGGG - Intergenic
1181159034 22:20945770-20945792 TGCAGCTCCGTGAGGGCCAGGGG + Intronic
1181166697 22:20987749-20987771 CTCAGGGCCGTTAGGGCAAGGGG - Intronic
1181773528 22:25143722-25143744 TCCAGGGCCCTCAGGGCTTGTGG - Intronic
1183476647 22:38039364-38039386 TGCAGGGCTGTGAGGGGACGTGG - Intronic
1184560987 22:45262865-45262887 TCCAAGCCTGTGAGGGCAGGGGG + Intergenic
1184839414 22:47043772-47043794 TCCAAGGCTCTGAGGGCAGGGGG + Intronic
1185417389 22:50717730-50717752 TCCAGGGCCCTGAGGCAATGAGG - Intergenic
950454376 3:13083975-13083997 CCCAGGGAGGTGAGGGGAAGGGG + Intergenic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
954290981 3:49649920-49649942 TCCAGAGCCCTGGGGGCAGGAGG + Intronic
954708228 3:52492352-52492374 GCCAGGGCCGTGAAGTCCAGTGG + Exonic
954972539 3:54663389-54663411 CCCAGGGCCATGAAGGCATGAGG - Intronic
956412452 3:68993037-68993059 TCCAGGCCTGTGATGGGAAGCGG + Intronic
958993362 3:100873419-100873441 TCCAGGGCAGGGAGGGAAAGGGG + Intronic
961453290 3:127012204-127012226 CCCAGGGCCGTGAGGATAACCGG - Intronic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
962272259 3:133986504-133986526 TGCAGGGCAGGGAGGGCAGGAGG + Intronic
963199093 3:142568694-142568716 TCCAAGTCTGTGAGGGCAGGGGG - Intronic
964623256 3:158735733-158735755 TCGTGGACCCTGAGGGCAAGGGG - Intronic
965361134 3:167739622-167739644 TCCAGGGCCTTGAGGTTAAATGG - Intronic
967387809 3:188928158-188928180 ACCAGGGCCAAGGGGGCAAGTGG - Intergenic
967931802 3:194695423-194695445 TCAAAGGCCGTGAGGGCATCTGG + Intergenic
968616286 4:1579177-1579199 GCCAGGGCAGGGAGGGCAGGGGG - Intergenic
969393877 4:6908664-6908686 TCTGGGGACTTGAGGGCAAGAGG - Intergenic
969520365 4:7674658-7674680 GGCAGGGCAGTGAGGGGAAGGGG + Intronic
970045166 4:11844138-11844160 CGCAGGACCATGAGGGCAAGTGG + Intergenic
970609875 4:17714980-17715002 TGCAGGGAGGTGAGGGGAAGGGG - Intronic
970650730 4:18174911-18174933 TCCAGGTCAGGGAGGGGAAGAGG + Intergenic
979524023 4:121698264-121698286 GCCAGGGCAGAGGGGGCAAGAGG + Intergenic
984296558 4:177861679-177861701 TCCAAGCCTGTGGGGGCAAGGGG - Intronic
986437224 5:7746076-7746098 TCCAGGGACGGGAGGGCAGGAGG - Intronic
986735001 5:10662023-10662045 TCCTGGGCTGTGAGTGCATGTGG - Intergenic
987161503 5:15148921-15148943 TCCAGAAACTTGAGGGCAAGAGG + Intergenic
987457600 5:18165921-18165943 TCCAGGCCTGTGATGGGAAGGGG + Intergenic
989478842 5:41904525-41904547 TCGATGGCTGTGAGGGCTAGAGG + Intronic
992126342 5:73646085-73646107 TCCAGGGCAGGGAAGGCAGGAGG - Intronic
992198817 5:74364569-74364591 TCCAAGGCCCTGATGGCAGGAGG + Intergenic
992564800 5:77986507-77986529 TCCAGGTCTGAGAGGGCAAGGGG + Intergenic
993418062 5:87660003-87660025 TCCAGGGCGGGGCGGGAAAGGGG + Intergenic
998175039 5:139896502-139896524 TCCTGGCTAGTGAGGGCAAGGGG + Intronic
1000395680 5:160772514-160772536 TCCAGGGATGTGGGGGCATGAGG + Intronic
1002757077 6:172415-172437 TTCAGGGCTGTGATGGGAAGGGG - Intergenic
1003555692 6:7137784-7137806 TCCAGGGCAGGGAGAGGAAGAGG - Intronic
1005831649 6:29675883-29675905 TCCAGGGCCCTTAGGACAGGGGG + Intronic
1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG + Intronic
1006285637 6:33092082-33092104 GCCAAGGCCGTGAGGGCAGAGGG + Intergenic
1006573616 6:35026427-35026449 GCCAGCTCCATGAGGGCAAGAGG - Intronic
1006981861 6:38153813-38153835 TCCAGGTGGGTGAGGGCAGGAGG + Exonic
1007385436 6:41517372-41517394 TGCAGAGCCCTGAGGGCCAGTGG + Intergenic
1010627469 6:78155924-78155946 CCCAGGGTGGTGTGGGCAAGTGG + Intergenic
1013705873 6:112833296-112833318 TCCAGGGCAGAGAGGGCCTGAGG - Intergenic
1013779961 6:113718386-113718408 TCCAGGGAAGAGAGTGCAAGAGG - Intergenic
1014042914 6:116850555-116850577 TCCAGGCCTGTGAGGGGAGGGGG - Intergenic
1018228957 6:161657231-161657253 TCCAGAGCCGTGAGGTCACTGGG - Intronic
1019356588 7:583050-583072 GCCAGGGCCGGGAGGGCAGGGGG + Intronic
1019490520 7:1311154-1311176 TGAAGGGCCGCGAGGGGAAGAGG - Intergenic
1019496973 7:1345334-1345356 GCCAGGGCCGGGAAGGCAGGTGG + Intergenic
1023104405 7:36749422-36749444 TCCAGGGGCTTGGGGGCAAAGGG + Intergenic
1029479660 7:100804926-100804948 CCCAGGGCTGTGATGGCAGGAGG + Intronic
1030213572 7:107020558-107020580 TTCAAGGCAGTGAGAGCAAGGGG + Intergenic
1035049699 7:155991726-155991748 TCCAGGGTCGTGGGGGAAGGAGG + Intergenic
1035739316 8:1914277-1914299 TCCAGGGATGTGTGGCCAAGTGG + Intronic
1037980099 8:23247012-23247034 GCCAGGGCCGCGAGGGCGGGCGG + Intronic
1038646313 8:29365336-29365358 TCCAGGGCCCTGAGGGGCAGCGG + Intergenic
1041362476 8:57067500-57067522 TCCAGGGGCATGAGGACATGAGG + Intergenic
1041778707 8:61554155-61554177 GCCAGGGCCCTGTGGGCATGTGG - Intronic
1044458208 8:92413561-92413583 TCCAGGGACATGAGGCCATGTGG - Intergenic
1044468316 8:92534356-92534378 TCCAAGGCTTTGGGGGCAAGTGG + Intergenic
1048496812 8:134942374-134942396 TCAAGGGCAGTGCGGGCAAGTGG - Intergenic
1049697004 8:143989160-143989182 TCCAAGGGCGGGAGGGCAGGTGG + Intronic
1049988520 9:972633-972655 TCCAGGACGGTGTGGGGAAGCGG + Intergenic
1056007033 9:82283823-82283845 TACAGGGCTGTGATGGCAACTGG + Intergenic
1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG + Intergenic
1059803668 9:117775580-117775602 CCCAGGGGCTTGAGGGCAATGGG + Intergenic
1060488315 9:124063430-124063452 TCCTGGCCCAGGAGGGCAAGAGG - Intergenic
1061834261 9:133318410-133318432 TCCAGGGTCGTGAGGGTCATGGG - Intergenic
1062238068 9:135522122-135522144 TCCAGGGTCGTGAGGGTCATGGG - Exonic
1062696538 9:137878743-137878765 TCCAGGGCCCCGAGGGGAGGGGG - Intronic
1187388887 X:18873026-18873048 CCCAGGGCCATGGGGACAAGCGG - Intergenic
1187723171 X:22173196-22173218 TCCAGTGCCATGATGGCCAGGGG - Intronic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1190876833 X:54466005-54466027 TACAGGCCAGTGAGGCCAAGAGG + Intronic
1198321231 X:135520930-135520952 TACGCGGCAGTGAGGGCAAGAGG + Exonic