ID: 928099536

View in Genome Browser
Species Human (GRCh38)
Location 2:28427969-28427991
Sequence AAGCTTGGACAACTGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928099529_928099536 4 Left 928099529 2:28427942-28427964 CCACCCGGGTCCTCTCTTGGCAC No data
Right 928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG No data
928099527_928099536 14 Left 928099527 2:28427932-28427954 CCTTGCAGAGCCACCCGGGTCCT No data
Right 928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG No data
928099530_928099536 1 Left 928099530 2:28427945-28427967 CCCGGGTCCTCTCTTGGCACAGG No data
Right 928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG No data
928099532_928099536 0 Left 928099532 2:28427946-28427968 CCGGGTCCTCTCTTGGCACAGGT No data
Right 928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG No data
928099533_928099536 -6 Left 928099533 2:28427952-28427974 CCTCTCTTGGCACAGGTAAGCTT No data
Right 928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928099536 Original CRISPR AAGCTTGGACAACTGGACAT TGG Intergenic
No off target data available for this crispr