ID: 928102131

View in Genome Browser
Species Human (GRCh38)
Location 2:28444987-28445009
Sequence CTTATTCTCAGCCCTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928102126_928102131 4 Left 928102126 2:28444960-28444982 CCTGGGCCAGTAGGCTTCCCTGC No data
Right 928102131 2:28444987-28445009 CTTATTCTCAGCCCTGTGTTTGG No data
928102127_928102131 -2 Left 928102127 2:28444966-28444988 CCAGTAGGCTTCCCTGCCTCACT No data
Right 928102131 2:28444987-28445009 CTTATTCTCAGCCCTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928102131 Original CRISPR CTTATTCTCAGCCCTGTGTT TGG Intergenic
No off target data available for this crispr