ID: 928102944

View in Genome Browser
Species Human (GRCh38)
Location 2:28449991-28450013
Sequence GTTTCACTGGGGTCAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928102944_928102955 25 Left 928102944 2:28449991-28450013 CCACCCACTGACCCCAGTGAAAC No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928102944 Original CRISPR GTTTCACTGGGGTCAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr