ID: 928102955

View in Genome Browser
Species Human (GRCh38)
Location 2:28450039-28450061
Sequence CCTTGAATTCTCAGAATCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 198}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928102948_928102955 13 Left 928102948 2:28450003-28450025 CCCAGTGAAACCCTCCCTGTGAT No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102942_928102955 27 Left 928102942 2:28449989-28450011 CCCCACCCACTGACCCCAGTGAA No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102946_928102955 21 Left 928102946 2:28449995-28450017 CCACTGACCCCAGTGAAACCCTC No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102943_928102955 26 Left 928102943 2:28449990-28450012 CCCACCCACTGACCCCAGTGAAA No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102953_928102955 -2 Left 928102953 2:28450018-28450040 CCTGTGATGACATCATCATTACC No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102952_928102955 -1 Left 928102952 2:28450017-28450039 CCCTGTGATGACATCATCATTAC No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102941_928102955 28 Left 928102941 2:28449988-28450010 CCCCCACCCACTGACCCCAGTGA No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102951_928102955 2 Left 928102951 2:28450014-28450036 CCTCCCTGTGATGACATCATCAT No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102945_928102955 22 Left 928102945 2:28449994-28450016 CCCACTGACCCCAGTGAAACCCT No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102950_928102955 3 Left 928102950 2:28450013-28450035 CCCTCCCTGTGATGACATCATCA No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102944_928102955 25 Left 928102944 2:28449991-28450013 CCACCCACTGACCCCAGTGAAAC No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102949_928102955 12 Left 928102949 2:28450004-28450026 CCAGTGAAACCCTCCCTGTGATG No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198
928102947_928102955 14 Left 928102947 2:28450002-28450024 CCCCAGTGAAACCCTCCCTGTGA No data
Right 928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG 0: 1
1: 0
2: 5
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928102955 Original CRISPR CCTTGAATTCTCAGAATCAC CGG Intergenic
900698142 1:4025633-4025655 CCTCTAGTTCTCAGGATCACAGG + Intergenic
901793729 1:11668479-11668501 CCTTGAATTCCCAGGCTCAAGGG + Intronic
902221510 1:14968852-14968874 CCTGGAATGCTCTGAACCACAGG - Intronic
903264677 1:22150717-22150739 CCTTGGAATCCCAGAATCACAGG - Intergenic
908799912 1:67868945-67868967 CATTAAAGTCTCAGAAACACTGG - Intergenic
909894972 1:81057438-81057460 CCTGTAATCCTCAGCATCACAGG - Intergenic
910169370 1:84361118-84361140 CCTGGAACTCTTAGTATCACAGG + Intronic
910661271 1:89675685-89675707 CCTTGAACTCTCAATATCATTGG - Intronic
915536568 1:156539776-156539798 CCTTGAAGTCTCAGACCCTCAGG + Intronic
920812736 1:209302601-209302623 CCTTGATTTCTCAGTTTCACTGG - Intergenic
921825756 1:219670233-219670255 CATAAAATTCACAGAATCACAGG + Intergenic
922988876 1:229888027-229888049 CCTTCAATCCTCAGATTCCCTGG + Intergenic
1062880010 10:970454-970476 CTATGAATTATCAGAATCCCTGG + Intergenic
1063334992 10:5203501-5203523 GCCTGAATTCTCAGATTCCCTGG + Intronic
1063684742 10:8226050-8226072 CCTTGAACTCTCAGGCTCAATGG + Intergenic
1064784044 10:18874683-18874705 AATTGAATTCTCAGTCTCACAGG + Intergenic
1064895676 10:20233555-20233577 ACTTGAAGTCTCAGAAGCTCAGG + Intronic
1066080224 10:31923312-31923334 CCCTGCATTCTCAAAAACACTGG - Intronic
1066309851 10:34185930-34185952 CCTTTAATTCTCACAACCCCAGG + Intronic
1068276486 10:54805543-54805565 CCTTGAATTCTGACAATAAAAGG - Intronic
1068814239 10:61291718-61291740 CCTTTCATTCCCAGATTCACTGG - Intergenic
1069692834 10:70364967-70364989 CCTTGAATTTTGAGAATCACTGG - Intronic
1070400162 10:76046282-76046304 CCATAGATTCACAGAATCACAGG - Intronic
1070432165 10:76351683-76351705 ACTAGAGTTCTAAGAATCACCGG - Intronic
1073606660 10:104902363-104902385 CCATGACCTCTCAGAGTCACTGG - Intronic
1073819576 10:107245600-107245622 CTATTAATTCTCAGAAGCACAGG - Intergenic
1074837762 10:117315069-117315091 CCTAGAATTCCCAGATTCAGAGG + Intronic
1075951599 10:126482501-126482523 CCTTGCCTTCACAGAAGCACAGG + Intronic
1077773654 11:5248328-5248350 CCTTGAAAGCTCTGAATCATGGG + Exonic
1077922015 11:6648385-6648407 ACTTGAATTCTCAGCAGCATTGG - Intronic
1077999851 11:7485007-7485029 CCTTGAGTTTTCTCAATCACTGG - Intergenic
1078147961 11:8735040-8735062 CCATGAATTCTCAGCAGCTCAGG + Intronic
1078812559 11:14783002-14783024 ACTTGAATGCTCATCATCACTGG + Intronic
1079259301 11:18863042-18863064 CATTGAATTCTCAGATACAGGGG - Intergenic
1080157384 11:29127764-29127786 ACATGTATTCTCAGAATCATAGG - Intergenic
1081964850 11:47163264-47163286 CCTGGTGTCCTCAGAATCACAGG + Intronic
1083249817 11:61459083-61459105 CCTTGACTTCCCAGACTCAAGGG + Intronic
1084097217 11:66919482-66919504 CCTGGAGATCTCAGAGTCACAGG - Intronic
1085152730 11:74265148-74265170 CCTGGACTTCTCAGAATTACAGG - Intronic
1085364320 11:75925067-75925089 GCTTGAATTCACAGAGTTACTGG + Intronic
1088448070 11:109953632-109953654 CCTAGAAGTCTTAGAATCCCTGG + Intergenic
1088948686 11:114542293-114542315 CCTTTAATTATAAGAGTCACAGG + Intronic
1089856168 11:121546820-121546842 CCTTAAAGTTTCAGAAGCACTGG - Intronic
1090906019 11:131075304-131075326 CCTTCAAATCTCAGACTCTCTGG - Intergenic
1091084548 11:132708258-132708280 CCTACAATCCTCACAATCACAGG + Intronic
1092623118 12:10295424-10295446 ACTGGAATTCTGAGATTCACAGG - Intergenic
1092984953 12:13836463-13836485 CCCTGAATTGCCAGCATCACTGG - Intronic
1094266795 12:28568757-28568779 CATTAAATTCTCTGAATAACAGG - Intronic
1095214207 12:39528870-39528892 CCTTCAATTATCAGAGTCAGTGG + Intergenic
1095847938 12:46767063-46767085 CCTTGATTTTTAATAATCACAGG - Intronic
1096461388 12:51822976-51822998 CCTTGGAATCTCAGAATCTCAGG - Intergenic
1097159302 12:57035047-57035069 ACTGGAATACTCAGAAACACTGG + Intronic
1097442102 12:59621572-59621594 CCTTGTAATCTAAGAATGACAGG - Intronic
1097939090 12:65284209-65284231 CCTTGAAATGTCATAATCAGAGG + Intronic
1098231629 12:68377173-68377195 CATTGAAGTCTGAGAAGCACTGG + Intergenic
1106035426 13:26040255-26040277 CCTTCAATTCTCAGTATAAATGG + Intergenic
1107106292 13:36646761-36646783 CATTGTACTCTCAGACTCACAGG + Intergenic
1108077484 13:46696526-46696548 CCTTGAAATCTCTGAATCCAGGG - Intronic
1108243478 13:48491860-48491882 TATTGAATTCTTAGAATCACAGG - Intronic
1111414741 13:87924495-87924517 CTCTGAATTCTCTGAATCCCTGG + Intergenic
1111559852 13:89931100-89931122 CCCAGAATTCTCAGAGGCACAGG + Intergenic
1111904072 13:94235224-94235246 TCTTGAAATATCAGAACCACTGG - Intronic
1112428905 13:99332465-99332487 CCTTACATTCTCAGACTTACAGG + Intronic
1113118238 13:106897028-106897050 TCATAAATTTTCAGAATCACAGG + Intergenic
1113162079 13:107392913-107392935 TCTTGCAATCTCAGAATAACAGG - Intronic
1113544713 13:111139445-111139467 CTCTGAACTGTCAGAATCACAGG + Intronic
1113625842 13:111845783-111845805 CCTTGAATTACGAAAATCACAGG + Intergenic
1114470233 14:22956222-22956244 CCTTAAGTTCTCAGAAGCAACGG - Intronic
1114942383 14:27629950-27629972 CCGTGAACTCTCAGACCCACGGG - Intergenic
1115711984 14:36060988-36061010 CCTGGAATTCACAGAAATACTGG - Intergenic
1118792468 14:69107513-69107535 CCTTAAAGTTTGAGAATCACTGG + Intronic
1120504780 14:85341762-85341784 CCTTGACTTCTCAGACTCAAGGG - Intergenic
1120711128 14:87794129-87794151 CTTTGATTTCTCTGAATCACAGG + Intergenic
1120945007 14:89986373-89986395 CATTTAATCCTCACAATCACGGG - Intronic
1122219428 14:100226902-100226924 CCTTGACTTCCCAGGCTCACGGG - Intergenic
1125717845 15:41829766-41829788 CCATGTATTTTCAGAATCCCAGG + Intronic
1130157452 15:81363918-81363940 CCCTGAAGTCTAAGAAGCACAGG + Intronic
1132384950 15:101393626-101393648 CCTTAAAATTGCAGAATCACAGG + Intronic
1133707027 16:8364562-8364584 TCTTGAATTCCCAGACTCAAGGG + Intergenic
1136691446 16:32034025-32034047 CCTTGAATTCTCAGAATTGCTGG - Intergenic
1136792034 16:32977590-32977612 CCTTGAATTCTCAGAATTGCTGG - Intergenic
1136877783 16:33876318-33876340 CCTTGAATTCTCAGAATTGCTGG + Intergenic
1140117812 16:72057892-72057914 CCTTTCATTCTCAGAACCAGAGG + Intronic
1141393957 16:83688318-83688340 ACTGGCATTCTCAGAAACACAGG + Intronic
1203094244 16_KI270728v1_random:1239054-1239076 CCTTGAATTCTCAGAATTGCTGG - Intergenic
1143418507 17:6769826-6769848 CCCTGAAAACTCAAAATCACAGG - Intronic
1146769237 17:35553436-35553458 CCTTGAATTTTCAGTGACACAGG - Exonic
1147371456 17:39995757-39995779 CCTTATATTCTCACACTCACAGG - Intronic
1147865504 17:43549382-43549404 CTTTGAACTCACAGACTCACAGG + Intronic
1148972012 17:51491691-51491713 GCCTGAATTCTCAGGAGCACTGG + Intergenic
1149338887 17:55666220-55666242 CATTGAAATATCAGCATCACAGG + Intergenic
1150009495 17:61491011-61491033 CCTTACATTCTCAGAACCAGGGG - Intergenic
1152195226 17:78914166-78914188 CCTTGAGTCCTCAGAGGCACAGG + Intronic
1152223642 17:79082702-79082724 CATTCGATTATCAGAATCACGGG - Intronic
1153873780 18:9346556-9346578 TCTTGAATTCTCAGCCTCAAGGG - Intronic
1154139893 18:11813919-11813941 CCTTGAATCCTTAGTATCTCTGG - Intronic
1155180464 18:23340885-23340907 ACTTGAGTTCTCAGCATCACTGG - Intronic
1155433233 18:25783871-25783893 CCTTTTATTCTCAGCATCTCGGG + Intergenic
1161412638 19:4124862-4124884 CCTAGAATCATCAGATTCACAGG - Intergenic
1164802315 19:31087892-31087914 CCTTGAACTCCCTGAATCAAGGG + Intergenic
1166216769 19:41340978-41341000 CTTTGAATTCCAACAATCACAGG + Intronic
1166497825 19:43316964-43316986 ACTTGAATTCTCAGCAACGCGGG - Intergenic
927188224 2:20497658-20497680 CCCTAGATTCTCAGATTCACTGG - Intergenic
928102955 2:28450039-28450061 CCTTGAATTCTCAGAATCACCGG + Intergenic
928902826 2:36338871-36338893 CCAATAATTCTCAGAATCAGGGG + Intergenic
929261920 2:39875556-39875578 CTTTGAATTCTGAGAAAAACTGG + Intergenic
930353213 2:50284073-50284095 CATTGAAGACTCAGAATCATAGG - Intronic
932951114 2:76294761-76294783 CCTGGAATTCAGAGAATAACAGG - Intergenic
935107744 2:100061412-100061434 TCTTTATGTCTCAGAATCACAGG + Intronic
939469649 2:142604150-142604172 CCTAGAATTCTGAGAATTAATGG - Intergenic
940199218 2:151131796-151131818 CCTAGAATTTTCAGAATGAGTGG + Intergenic
941219355 2:162756546-162756568 CCTTGAACTCTCAGGCTCAGGGG + Intronic
942306087 2:174608910-174608932 CCTTGGATTCTCAGGAACAAGGG + Intronic
943063529 2:183062814-183062836 CCTTGAATTCCCAGGCTCAAGGG - Intergenic
946217812 2:218199241-218199263 CCATGCATTTTCAGAATCAGTGG - Intergenic
947532369 2:230919651-230919673 AGGTGAATTCTCAGAATCACTGG - Intronic
1169420684 20:5456795-5456817 CCTTGAACTCTCAGACTCAATGG + Intergenic
1170083188 20:12499381-12499403 CCATGAAATCTAACAATCACAGG + Intergenic
1170317684 20:15060528-15060550 CCTTGGCTTCTCAGATTGACTGG + Intronic
1170540259 20:17380571-17380593 AATTGAATTATCACAATCACCGG - Intronic
1171401707 20:24877091-24877113 CCTTGACTTCCCACAATGACAGG - Intergenic
1172891314 20:38267752-38267774 CCTGGAAATCTCAAAATCACAGG - Intronic
1173330476 20:42072019-42072041 CATGGAATACTCAGAATCAAGGG - Intergenic
1173386497 20:42593166-42593188 TCATGGAATCTCAGAATCACTGG + Intronic
1174975202 20:55325313-55325335 CCTTGAGAATTCAGAATCACTGG - Intergenic
1177017157 21:15806327-15806349 AATTGTATACTCAGAATCACTGG - Intronic
1178597700 21:33969672-33969694 ACTCTAATTCTCAGAATCAGAGG - Intergenic
1179601792 21:42483315-42483337 CCTTAAATTCTCAGAATTTCTGG + Intronic
1180937969 22:19638336-19638358 CCATGAATTAGCAGAATCTCAGG + Intergenic
1183267651 22:36839116-36839138 GCCTGAATTCTCACCATCACAGG + Intergenic
1203215050 22_KI270731v1_random:1557-1579 CCTAGAATGCTCAGCATCCCTGG + Intergenic
951582901 3:24184717-24184739 CCTTGAGGTATAAGAATCACTGG + Intronic
952196340 3:31079309-31079331 CTTTGTATTCACAGGATCACAGG + Intergenic
952827264 3:37534340-37534362 CCTAGCATTGTCAGCATCACTGG + Intronic
955222735 3:57036821-57036843 CTTTGATTACTGAGAATCACAGG + Intronic
955533941 3:59903583-59903605 ATTTTAATTCTCAGAATAACAGG - Intronic
957005884 3:74946333-74946355 CCTGGAATTCTAGGAATTACTGG + Intergenic
959445166 3:106430292-106430314 TCTTGAATTCTCAGCCTCAGGGG + Intergenic
959916384 3:111821101-111821123 CACTGGATACTCAGAATCACTGG - Intronic
959938893 3:112059801-112059823 CCTTTAATCCTTAAAATCACAGG + Intronic
961169580 3:124787233-124787255 GCTTAGATTTTCAGAATCACAGG + Intronic
963461205 3:145617058-145617080 CCTGGATTTCTCAGAACTACCGG + Intergenic
964320117 3:155486902-155486924 TCTTGAATTCTAGGAATCCCAGG - Intronic
964668208 3:159196740-159196762 CCTTGATTTCTCTGAAACATGGG - Intronic
965691187 3:171358516-171358538 CCTTGAATTGTAATAATCCCCGG - Intronic
966036030 3:175416036-175416058 CCTTGAAATCCCAGGCTCACGGG - Intronic
966729032 3:183135125-183135147 CCTTGAGTTCTGACCATCACAGG - Intronic
966742981 3:183251147-183251169 GTTTGAATTCACAGATTCACTGG + Intronic
967528596 3:190522851-190522873 CACTGAAATCTAAGAATCACTGG + Intronic
969144442 4:5109155-5109177 CCCTGACATCTCAGAATCTCAGG + Intronic
969229657 4:5821172-5821194 CCGTGAATTCTCGGAATGGCAGG - Exonic
972337267 4:38118364-38118386 CCTTAACTTCTGATAATCACGGG + Intronic
975727320 4:77304693-77304715 CCTTCATCACTCAGAATCACTGG - Intronic
978371412 4:108033114-108033136 CCTTGAATTCTCCCTATCACAGG - Intronic
981662375 4:147183138-147183160 GCTTGATTTCTCAGACTCCCTGG - Intergenic
982422725 4:155215775-155215797 GCTGAAATTCTCAGAATTACAGG + Exonic
982667828 4:158288318-158288340 CCATAAATTTTCAGAATCTCTGG - Intergenic
985126558 4:186700775-186700797 CATTTAATTCTCACAACCACCGG - Intronic
986350419 5:6873228-6873250 AATTGATTTCTTAGAATCACTGG + Intergenic
989169938 5:38464016-38464038 CCTTCTATTCTGAGAATCCCAGG + Exonic
989210775 5:38856723-38856745 CCTTGAACTCCCAGAAACAAGGG + Intronic
991649883 5:68841010-68841032 ACTTGAATTCTCTGTATCAATGG - Intergenic
992739514 5:79759159-79759181 CTTTGAGCTCTCAGAATAACAGG + Intronic
992940994 5:81761228-81761250 CCTTGTATTCTTAGAAACAACGG + Intergenic
993745712 5:91594316-91594338 CTTTGATTTCTCAGAGTAACTGG - Intergenic
995369846 5:111406965-111406987 GATTTAATTCTCAGAATCATAGG + Intronic
996617153 5:125455830-125455852 CCTTGACATCTCAGTATCACTGG + Intergenic
996721586 5:126635760-126635782 CCTTGATTTCCCAGGATCAAGGG + Intronic
999271500 5:150298789-150298811 CATCGAATCCTCAAAATCACTGG + Intronic
1000881055 5:166697981-166698003 GCCTGAATCCTGAGAATCACTGG + Intergenic
1001107878 5:168870834-168870856 CCTTGTATTCTGAGAAACTCTGG - Intronic
1002675625 5:180910126-180910148 ATTTTAATTCTCAGAATCTCAGG + Intronic
1003644069 6:7900141-7900163 ACTTGAATTCTCACAGTAACTGG - Intronic
1004069311 6:12283543-12283565 CCATGAATGGTCAAAATCACTGG + Intergenic
1004852629 6:19715815-19715837 CCTTCAATTCCCACAAACACAGG - Intergenic
1004978828 6:20999109-20999131 CTTTGAAAACTAAGAATCACTGG + Intronic
1005972267 6:30770720-30770742 CATTTACTTCACAGAATCACAGG + Intergenic
1006119004 6:31792663-31792685 CCTAGAAATGGCAGAATCACTGG - Intronic
1010716836 6:79239793-79239815 CCTTCAAATCTCAGAATCCCTGG + Intergenic
1012031392 6:94070397-94070419 CCCTGCATTTGCAGAATCACTGG - Intergenic
1014425359 6:121298051-121298073 CATTGTATTTTCAGAATCAAGGG - Intronic
1015552136 6:134422682-134422704 TCTTGAATTCTAAGCATAACTGG - Intergenic
1016085583 6:139909893-139909915 ACATGAATTCAAAGAATCACGGG - Intergenic
1018070678 6:160161719-160161741 CCTGGAATCCTCACAACCACTGG - Intergenic
1018917945 6:168149142-168149164 ACGTGGAATCTCAGAATCACCGG + Intergenic
1021215069 7:17905887-17905909 CCTCCAATTCTGAGACTCACAGG + Intronic
1022630595 7:32080736-32080758 CTTTCACTTCTGAGAATCACAGG - Intronic
1022866683 7:34428889-34428911 CATTGAATGCTCAGAACCATAGG - Intergenic
1023247027 7:38215929-38215951 CTGAGCATTCTCAGAATCACGGG + Intronic
1025133407 7:56390637-56390659 CCTTGACTCCTCAGATTCTCAGG + Intergenic
1027672417 7:81118369-81118391 CTTTGAACTTTAAGAATCACTGG - Intergenic
1028717294 7:93985960-93985982 CATTTAAATCTCAGTATCACAGG - Intronic
1030880372 7:114870691-114870713 CTTTGGATTTTCAGAATCTCTGG + Intergenic
1038059056 8:23892181-23892203 CCTTGAGGTCACAGAATCAAAGG - Intergenic
1041045745 8:53884277-53884299 CCTTGAACTCCCAGATTCAAAGG + Intronic
1041131088 8:54701266-54701288 TCTTGATTTCTCAGAATCCATGG - Intergenic
1041475081 8:58255896-58255918 TCTGGAATTCTCGAAATCACTGG + Intergenic
1044311201 8:90694906-90694928 GATTGCATTCTCAGAATCCCTGG + Intronic
1046202929 8:110950930-110950952 CCTTGATCTCTCAGAGTGACTGG - Intergenic
1046287637 8:112115391-112115413 CCTTGAAATCTCAGAAGCTAGGG - Intergenic
1046742264 8:117842097-117842119 CCCTAAATTTTCAGAACCACTGG + Intronic
1047434982 8:124828873-124828895 CCTTGGAGTCTCAGGGTCACTGG - Intergenic
1047925104 8:129675127-129675149 GCTTGAATTCTCAGAATCCTAGG + Intergenic
1048661936 8:136614495-136614517 ACTAGAATTCCCAGAAGCACAGG + Intergenic
1051912538 9:22170878-22170900 CCTTGAATTCTGAGAACTTCTGG - Intergenic
1052284491 9:26769465-26769487 CCTTGAGTTTCTAGAATCACTGG - Intergenic
1052884954 9:33636461-33636483 ACAAGAATTCTCTGAATCACTGG + Intergenic
1055891531 9:81129318-81129340 CCTTAATTTCTCAGAACCTCAGG + Intergenic
1058188632 9:101886542-101886564 CCTTGAATTCTTAGGCTCAAGGG + Intergenic
1058259806 9:102814592-102814614 CCCTGCATGCTAAGAATCACTGG + Intergenic
1058597242 9:106628552-106628574 CCTTTAATTCCAAGAATTACAGG - Intergenic
1059031148 9:110697676-110697698 CATTGATTACTCACAATCACTGG + Intronic
1059612668 9:115916121-115916143 ACTTAAATTTTCAGAATCTCAGG - Intergenic
1059643485 9:116240243-116240265 CCTTGAGTTTTCAGCACCACTGG - Intronic
1187772434 X:22715351-22715373 CCAGGAATTCCCAGGATCACTGG - Intergenic
1188047743 X:25447647-25447669 ACTTGAATTCTTAGAATAAAGGG + Intergenic
1188451431 X:30310937-30310959 CCTGGAATTCTCAGCATAAGAGG + Intergenic
1188963980 X:36527944-36527966 CCTCTAATTCTCAAAAACACAGG - Intergenic
1193441620 X:81546932-81546954 GCTTGAATTCTCATATTCATTGG + Intergenic
1197763683 X:130045363-130045385 GCTTGAAGTCACTGAATCACAGG + Intronic