ID: 928103591

View in Genome Browser
Species Human (GRCh38)
Location 2:28453467-28453489
Sequence TAGTTTAGCAAACCTGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928103591_928103595 -10 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103595 2:28453480-28453502 TGCTAAACTACTGACTCCCAGGG No data
928103591_928103604 18 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103604 2:28453508-28453530 TGACAGGGCCTGATGCAGGGTGG No data
928103591_928103605 25 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103605 2:28453515-28453537 GCCTGATGCAGGGTGGCCAGCGG No data
928103591_928103600 14 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103600 2:28453504-28453526 TCCCTGACAGGGCCTGATGCAGG No data
928103591_928103596 2 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103596 2:28453492-28453514 GACTCCCAGGGCTCCCTGACAGG No data
928103591_928103602 15 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103602 2:28453505-28453527 CCCTGACAGGGCCTGATGCAGGG No data
928103591_928103597 3 Left 928103591 2:28453467-28453489 CCCCAGACAGGTTTGCTAAACTA No data
Right 928103597 2:28453493-28453515 ACTCCCAGGGCTCCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928103591 Original CRISPR TAGTTTAGCAAACCTGTCTG GGG (reversed) Intergenic
No off target data available for this crispr